i thought about this, and i actually think the ndp would have a bigger pull under the imminent threat of a conservative win.
the conservatives will have a new leader in place before the election. patrick brown is off the ballot, but the party will still be on it. so, those people that are trained to vote for the conservative logo as a default replacement option will still be able to do so, and if the vote is explicitly against wynne then the replacement of brown should change little in the decision making process.
i'm not convinced that the backlash is so strong, right now. all of those polls had very high numbers of undecideds. but, there is no real reason to think a change in leadership will prevent it, if it is. andrea horwath has been there the whole time; the people that are singularly irate with wynne would already be leaning ndp, if they were so inclined.
i mean, the article is written as though brown is taking the entire conservative party out of the election, and the ndp are the only other option left standing. that's not an approximation of reality at all.
wynne is more likely to use this to appeal to centrist voters concerned about stability. the tories need to get their own party in order before they can start considering forming a government, kind of thing.
https://www.thestar.com/opinion/star-columnists/2018/01/25/patrick-brown-sex-scandal-boosts-fortunes-of-andrea-horwath-and-the-ndp.html
jagmeet singh must cut his beard.
Thursday, January 25, 2018
i think that fallout from the patrick brown situation is unclear; if you're the liberals, this is almost an act of god, and it's really just out of nowhere...
one substantive factor likely lies in how the conservative base reacts to it on social media and in conversation. the party might take swift actions to try and neutralize what it sees as a nightmare, in an attempt to appeal to...sane people, really. but, you know that the good old conservative base is going to yell and scream about feminism, and how he was set up by a clique of feminazis trying to silence him.
i'm not suggesting that such a movement has legs. not in ontario. not in 2017. but, these idiots are vocal, and this is the kind of troll that they love to get in people's faces on - and that people get pissy about, quickly. here's your free market, guys - you have no control over how your voters represent your image on social media, which is the media people actually use.
avoid your uncle on facebook this week.
and, the accusations are....they're substantive because she was underage. but, that's one of the arguments that the mras love to go to town with, isn't it? "i thought she was legal. how am i supposed to know?".
but, the candidates will address their opponents, and soon enough be eager to push patrick brown out of the news cycle. wynne probably wins by default, now. but, that zombie conservative vote really is stubborn, you know.
one substantive factor likely lies in how the conservative base reacts to it on social media and in conversation. the party might take swift actions to try and neutralize what it sees as a nightmare, in an attempt to appeal to...sane people, really. but, you know that the good old conservative base is going to yell and scream about feminism, and how he was set up by a clique of feminazis trying to silence him.
i'm not suggesting that such a movement has legs. not in ontario. not in 2017. but, these idiots are vocal, and this is the kind of troll that they love to get in people's faces on - and that people get pissy about, quickly. here's your free market, guys - you have no control over how your voters represent your image on social media, which is the media people actually use.
avoid your uncle on facebook this week.
and, the accusations are....they're substantive because she was underage. but, that's one of the arguments that the mras love to go to town with, isn't it? "i thought she was legal. how am i supposed to know?".
but, the candidates will address their opponents, and soon enough be eager to push patrick brown out of the news cycle. wynne probably wins by default, now. but, that zombie conservative vote really is stubborn, you know.
at
09:23
just so it's clear, the text at astana was largely written by the russians - and the americans weren't invited. i suppose it doesn't alter complicity. but, not only is this attack not nato-sanctioned, it's russian-orchestrated.
at
03:18
Wednesday, January 24, 2018
Osmund Cooke
Not sure if I was listening carefully, but can an enzyme split an atom and create nuclear fission?
Something like oxidoreductase or acid base catalysis
deathtokoalas
i believe you can find evidence for your hypothesis in the phenomenon of explosive diarrhoea.
at
19:51
this idea in the anti-gmo movement that you can absorb modified dna somehow is science fiction. organisms can steal dna from other organisms, but it is something that becomes less and less feasible as life becomes more and more complex.
what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.
maybe some diagrams might help.
suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata
your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata
your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.
there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.
jagmeet sing must cut his beard.
what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.
maybe some diagrams might help.
suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata
your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata
your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.
there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.
jagmeet sing must cut his beard.
at
19:17
an opportunity, perhaps, but, as justin is not his father, this is not the ndp of the 60s or the 70s, either. i frankly don't think they have the credibility on the left to put up a believable opposition to free trade. this is where the ghost of mulcair appears and haunts the ndp forever, as he was very tepid in his criticism of the tpp, and projected fairly clearly that he intended to support it if he had won in 2015. if i am correct that jagmeet singh is a creature of the ndp leadership, it's not even clear what the actual policy position even is, let alone if they can lead an opposition movement that is, issue-by-issue, well to the left of where the party currently sits.
in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.
i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...
https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html
jagmeet singh must cut his beard.
in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.
i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...
https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html
jagmeet singh must cut his beard.
at
18:39
but, what would you do if you were free?
i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.
see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.
immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.
unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.
because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.
so, what would you do if you were free?
then, do it.
jagmeet singh must cut his beard.
i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.
see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.
immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.
unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.
because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.
so, what would you do if you were free?
then, do it.
jagmeet singh must cut his beard.
at
11:49
Tuesday, January 23, 2018
so, they signed the tpp.
i would have rather seen a bilateral deal with japan...
why didn't they sign it previously? well, you'd think it probably had something to do with wanting to wait to see what was happening in the united states. a canadian entrance into the tpp could have severely complicated nafta talks.
and, the timing of signing on to the deal is no doubt informed by recent events around the nafta negotiation. that may seem ominous, but i think you can also read it the other way - the liberals may have calculated that trump will not be able to re-open nafta in the face of congressional opposition by 2024, and that these talks will rather go on until trump leaves or is removed from the white house. they may also have calculated that the united states will return to the tpp in 2022 or 2026.
the standard narrative is going to be that it's a pre-emptive reaction to the imminent collapse of nafta, but the facts would hardly uphold it. two-way trade is really only going to exist with japan and perhaps australia; the rest of the countries are going to act as...
trump thinks that the tpp is a backdoor for china. it's crazy. the tpp is the exact opposite: it's the reconstruction of the wartime japanese empire, to act as a counter-balance to contain the chinese with. so, the bulk of these countries exist in the deal to provide natural resources and labour to japanese multinationals, who will then sell the products in north america - or at least in canada. the labour provisions in the agreement are a joke, really.
then, you've got singapore for money laundering and other banking functions.
how is that going to replace nafta? the japanese market for beef is not that powerful, although the alberta farming lobby no doubt pushed hard for the deal.
it makes more sense to think that canada has made the choice to act independently of trump, for the reason that it doesn't have much faith in trump to chart a path, and rather has better reason to think the future will be designed by his opponents.
jagmeet singh must cut his beard.
i would have rather seen a bilateral deal with japan...
why didn't they sign it previously? well, you'd think it probably had something to do with wanting to wait to see what was happening in the united states. a canadian entrance into the tpp could have severely complicated nafta talks.
and, the timing of signing on to the deal is no doubt informed by recent events around the nafta negotiation. that may seem ominous, but i think you can also read it the other way - the liberals may have calculated that trump will not be able to re-open nafta in the face of congressional opposition by 2024, and that these talks will rather go on until trump leaves or is removed from the white house. they may also have calculated that the united states will return to the tpp in 2022 or 2026.
the standard narrative is going to be that it's a pre-emptive reaction to the imminent collapse of nafta, but the facts would hardly uphold it. two-way trade is really only going to exist with japan and perhaps australia; the rest of the countries are going to act as...
trump thinks that the tpp is a backdoor for china. it's crazy. the tpp is the exact opposite: it's the reconstruction of the wartime japanese empire, to act as a counter-balance to contain the chinese with. so, the bulk of these countries exist in the deal to provide natural resources and labour to japanese multinationals, who will then sell the products in north america - or at least in canada. the labour provisions in the agreement are a joke, really.
then, you've got singapore for money laundering and other banking functions.
how is that going to replace nafta? the japanese market for beef is not that powerful, although the alberta farming lobby no doubt pushed hard for the deal.
it makes more sense to think that canada has made the choice to act independently of trump, for the reason that it doesn't have much faith in trump to chart a path, and rather has better reason to think the future will be designed by his opponents.
jagmeet singh must cut his beard.
at
18:03
i don't see any value in this liberal strategy to try and deflect from
trudeau's privileged class status, not because it isn't in some sense a liability - and it should be stressed that this is an about-face from the glossy magazine photos that i criticized - but because it isn't believable.
everybody knows that justin trudeau is an aristocrat. so, attempts to deflect from or distort this seem like an attempt to construct a parallel reality, which i guess is only really an error insofar as it is so transparently fraudulent. they're just replacing one unbelievable narrative with another.
campaign rhetoric aside, no sane person thought justin trudeau was going to be a representative of the middle class, and that's not why he got elected. he was elected on a social liberalization platform, which was a bundle of ideas that included the right to wear scarves in public and the right to smoke up without going to jail. there was maybe some hope that he might bring in people that would help ensure our descendants have the right to live on a habitable planet, but these are the kinds of decisions that are made by corporate aristocrats, and the hope that he might have some influence was actually reliant on him using that elite status for influence.
i guess the cynical analysis is that the narrative shift is meant to accompany a policy shift that will align the liberals to the center-right, which is where they have tended to stabilize towards during long periods of safe governance, and where they've largely sat since coming back into office. they've tended to avoid this kind of messaging, but the recent absorption of the aging progressive conservative intelligentsia may be leading them to project phantom demographics into the future. that swing vote won't be replaced, when it dies, and it's almost dead; instead, you'll have a fundamental shift in the number of voters that call themselves 'liberals', because they always have been - and whether this is a 5% or 10% tipping point will determine if the conservative party is a viable vehicle moving into the future, and whether the ndp is a perpetual opposition party or not, as these no longer young voters have now overwritten their parents' conservative identity with their own liberal identity, and are consequently reachable from the left. the fact that the ndp is currently a distraction, at best, doesn't affect the demographics that are emerging.
in canada, that means a shift from a left that takes up 60-65% of the spectrum to a left that takes up 65-75% of it.
but, this is what happens to all liberal governments - they get some support from pragmatic conservatives at the beginning of their mandate, and then design their policies to try and appeal to conservative voters, then get confused when they crater on both sides, as those pragmatic conservatives still always prefer the conservatives, in the end.
if it were up to me, i would not be having trudeau making apologies for his status. i'd be having him demonstrate results to the cameras.
jagmeet singh must cut his beard.
everybody knows that justin trudeau is an aristocrat. so, attempts to deflect from or distort this seem like an attempt to construct a parallel reality, which i guess is only really an error insofar as it is so transparently fraudulent. they're just replacing one unbelievable narrative with another.
campaign rhetoric aside, no sane person thought justin trudeau was going to be a representative of the middle class, and that's not why he got elected. he was elected on a social liberalization platform, which was a bundle of ideas that included the right to wear scarves in public and the right to smoke up without going to jail. there was maybe some hope that he might bring in people that would help ensure our descendants have the right to live on a habitable planet, but these are the kinds of decisions that are made by corporate aristocrats, and the hope that he might have some influence was actually reliant on him using that elite status for influence.
i guess the cynical analysis is that the narrative shift is meant to accompany a policy shift that will align the liberals to the center-right, which is where they have tended to stabilize towards during long periods of safe governance, and where they've largely sat since coming back into office. they've tended to avoid this kind of messaging, but the recent absorption of the aging progressive conservative intelligentsia may be leading them to project phantom demographics into the future. that swing vote won't be replaced, when it dies, and it's almost dead; instead, you'll have a fundamental shift in the number of voters that call themselves 'liberals', because they always have been - and whether this is a 5% or 10% tipping point will determine if the conservative party is a viable vehicle moving into the future, and whether the ndp is a perpetual opposition party or not, as these no longer young voters have now overwritten their parents' conservative identity with their own liberal identity, and are consequently reachable from the left. the fact that the ndp is currently a distraction, at best, doesn't affect the demographics that are emerging.
in canada, that means a shift from a left that takes up 60-65% of the spectrum to a left that takes up 65-75% of it.
but, this is what happens to all liberal governments - they get some support from pragmatic conservatives at the beginning of their mandate, and then design their policies to try and appeal to conservative voters, then get confused when they crater on both sides, as those pragmatic conservatives still always prefer the conservatives, in the end.
if it were up to me, i would not be having trudeau making apologies for his status. i'd be having him demonstrate results to the cameras.
jagmeet singh must cut his beard.
at
17:29
the reasons trump is doing this don't have anything to do with workers; one might rather note trump's treatment of south korea as a chinese satellite with a level of alarm. but, it could very well provide incentives for korean and chinese businesses to manufacture more goods in the united states, which would indeed import some jobs from elsewhere into the united states. but, at what retaliatory cost is unclear.
i don't have any particular aversion to tariffs in principle, it's more that using them is a really tricky game that requires quite a bit of mathematical analysis and intelligent foresight - qualities the president does not have. tariffs should certainly not be used haphazardly as a hegemonic tool of control, but that box is already long open.
http://www.bbc.com/news/business-42784380
i don't have any particular aversion to tariffs in principle, it's more that using them is a really tricky game that requires quite a bit of mathematical analysis and intelligent foresight - qualities the president does not have. tariffs should certainly not be used haphazardly as a hegemonic tool of control, but that box is already long open.
http://www.bbc.com/news/business-42784380
at
03:35
Monday, January 22, 2018
"I think if we've learned anything during this process, it's that a
strategy to shut down the government over the issue of illegal
immigration is something the American people didn't understand, and
would not have understood in the future,"
indeed.
but, you understand it, mitch. so, at least until november, as the most high-ranking nominally sane republican congressional leader, it's your responsibility to thwart it.
jagmeet singh must cut his beard.
indeed.
but, you understand it, mitch. so, at least until november, as the most high-ranking nominally sane republican congressional leader, it's your responsibility to thwart it.
jagmeet singh must cut his beard.
at
17:19
i'm not particularly comfortable about letting donald trump shut down the government, guys. even if unintentionally, it may be a test run.
it's responsible republicans that need to make sure that this shut down is of a short duration.
jagmeet singh must cut his beard.
it's responsible republicans that need to make sure that this shut down is of a short duration.
jagmeet singh must cut his beard.
at
01:44
Sunday, January 21, 2018
so, what is happening in the conflict between iran and saudi arabia, right now?
it's a civil war in the persian empire. and the jews are being a nuisance to the hegemon, as always. but, it's a war that the iranians must win in order to rebuild their empire, their civilization - which is why anybody interested in stunting the iranian return to empire, as the western empire has been since the great game, perhaps on the strength of elizabethen era intelligence from russian agents, who were loosely aligned with the british at that time, but why anybody interested in stunting the iranian return to empire would back the saudis in that civil war.
might the turks be even better off in the persian sphere than in the greco-russian one? well, iran could act as a sort of pass through for a larger turkic confederation, as modern iran also has substantial turkic roots. the mongols didn't bring a direct population replacement themselves, but they opened up a vacuum for turkish tribes to migrate into. the mongols mostly wanted to go home. while they no doubt left descendants as the children of rape victims, the semi-apocalyptic conditions that these children were left to fend for themselves in would have had a staggering mortality rate. with the collapse of the entire economy, it would have been difficult to find food. and, you consequently might have become food, yourself - at the hands of animals, or perhaps of other humans. i'm speculating; there are no detailed records from this period, everybody was killed. the reports we have are from people travelling through, and they're grisly, but not detailed. there are no grounds besides speculative logical ones to suggest that the persian victims of the mongols resorted to cannibalism, but they might have. you have to wonder how many rape victims took advantage of their misfortune; it's protein, why throw it away?
we can state this much as fact: there was enough empty space to allow for substantive migration into iran from central asia, which is how the turks got to turkey in the first place. and, mortality rates aside, it started to seem like everybody around there looked a little bit racially mixed, all at the same time, around this point.
for, when the persians conquered the romans from the inside out, they were really conquering the greeks, as the romans were in the process of the germanic revolution at this point. if the turks reunite with the russians to recreate the greeks, will they end up conquered by the persians again? does history not state that this is inevitable?
well, we haven't tried it with russia as a base. what we know about history regarding russia is that it is a useful hideout for pirates - thugs, barbarians, terrorists. with the empire now in direct control of the barbarians, it might have an easier time with the persians. how's that for a long game in history? how's that for process?
really, the difference is this: if the turks unite with the persian empire, it could set off a regional war between iranian and russian empires for what is greece - the dardanelles, and the old city of byzantium. the entrance into the black sea, which russia will always seek strategic control over. on the other hand, if the turks unite with the russians, it could lead to an uneasy peace between russia and iran, while the iranians fight their civil war - which is setting up a longer term struggle for the eastern mediterranean, that israel may well have expanded into during the kerfuffle. so, it's a question of positioning - do the turks want to give the advantage to the russians or to the iranians?
i'm sure they'd rather direct the conflict to the south, at least.
economically speaking, a union with russia would provide for far greater opportunities than one with iran, just due to russia's sheer size. russia is almost unique amongst nations in having the resources to be largely self-sufficient in most things, so the sanctions have been less damaging than they could be, or have been on iran, which pales in resources. they might prefer to give the russians the advantage, if they are concerned primarily about self-interest.
these are questions for turkish leadership to weigh.
jagmeet singh must cut his beard.
it's a civil war in the persian empire. and the jews are being a nuisance to the hegemon, as always. but, it's a war that the iranians must win in order to rebuild their empire, their civilization - which is why anybody interested in stunting the iranian return to empire, as the western empire has been since the great game, perhaps on the strength of elizabethen era intelligence from russian agents, who were loosely aligned with the british at that time, but why anybody interested in stunting the iranian return to empire would back the saudis in that civil war.
might the turks be even better off in the persian sphere than in the greco-russian one? well, iran could act as a sort of pass through for a larger turkic confederation, as modern iran also has substantial turkic roots. the mongols didn't bring a direct population replacement themselves, but they opened up a vacuum for turkish tribes to migrate into. the mongols mostly wanted to go home. while they no doubt left descendants as the children of rape victims, the semi-apocalyptic conditions that these children were left to fend for themselves in would have had a staggering mortality rate. with the collapse of the entire economy, it would have been difficult to find food. and, you consequently might have become food, yourself - at the hands of animals, or perhaps of other humans. i'm speculating; there are no detailed records from this period, everybody was killed. the reports we have are from people travelling through, and they're grisly, but not detailed. there are no grounds besides speculative logical ones to suggest that the persian victims of the mongols resorted to cannibalism, but they might have. you have to wonder how many rape victims took advantage of their misfortune; it's protein, why throw it away?
we can state this much as fact: there was enough empty space to allow for substantive migration into iran from central asia, which is how the turks got to turkey in the first place. and, mortality rates aside, it started to seem like everybody around there looked a little bit racially mixed, all at the same time, around this point.
for, when the persians conquered the romans from the inside out, they were really conquering the greeks, as the romans were in the process of the germanic revolution at this point. if the turks reunite with the russians to recreate the greeks, will they end up conquered by the persians again? does history not state that this is inevitable?
well, we haven't tried it with russia as a base. what we know about history regarding russia is that it is a useful hideout for pirates - thugs, barbarians, terrorists. with the empire now in direct control of the barbarians, it might have an easier time with the persians. how's that for a long game in history? how's that for process?
really, the difference is this: if the turks unite with the persian empire, it could set off a regional war between iranian and russian empires for what is greece - the dardanelles, and the old city of byzantium. the entrance into the black sea, which russia will always seek strategic control over. on the other hand, if the turks unite with the russians, it could lead to an uneasy peace between russia and iran, while the iranians fight their civil war - which is setting up a longer term struggle for the eastern mediterranean, that israel may well have expanded into during the kerfuffle. so, it's a question of positioning - do the turks want to give the advantage to the russians or to the iranians?
i'm sure they'd rather direct the conflict to the south, at least.
economically speaking, a union with russia would provide for far greater opportunities than one with iran, just due to russia's sheer size. russia is almost unique amongst nations in having the resources to be largely self-sufficient in most things, so the sanctions have been less damaging than they could be, or have been on iran, which pales in resources. they might prefer to give the russians the advantage, if they are concerned primarily about self-interest.
these are questions for turkish leadership to weigh.
jagmeet singh must cut his beard.
at
04:49
i want to show you where this community is on a map:
there are no roads into this community, which has to deal with frozen ground for a substantial amount of the year. it's surrounded by marshes and wetlands, with little agricultural support and no meaningful industry, except perhaps logging. i don't think there are mines in the wetlands of northwestern ontario, although there are quite a few to the south and to the east.
i want the natives to have access to modern amenities. but, their request amounts to building them a city that has no potential economic base. it doesn't matter what you put into a community like this, if it is so poorly geographically positioned that it has no economy. imports into the city are going to need to be expensive, because it is so far removed from existing infrastructure. so, the only way the city would be able to survive and grow would be through increasingly large government subsidies. it doesn't make any sense to walk down this path, and so no government will actually do it.
i think it's worth acknowledging that the low quality of the land in the reserve is the reason that it was put aside for indigenous people, who were then rounded up from the outlying areas and placed in it. nothing could grow here, anyways, so it's of no loss to put the indigenous people there. now, we are faced with the absurd consequences of an unjust policy, the building of an isolated city in the marshland wilderness, and need to re-examine it from the core.
i think that if the trudeau government, or any government, is serious about housing in remote reserves, it needs to lay it out for these people: there will never be running water or sewer systems or stable electricity in these regions, because it makes no sense to build cities where there is no potential for economic activity. governments should nonetheless commit and strive towards moving these people into modern housing in serviceable areas, which may mean indigenous neighbourhoods in semi-rural or suburban areas, but not these remote villages in virtually uninhabitable places.
the government says things to win votes. if it were serious, it would stop the charade. and, as long as the charade continues, it should be seen as disingenuous.
the government's assimilation policy is as old as the country. what i'm suggesting is actually not dissimilar to what the elder trudeau, and his sidekick, chretien, tried to do in the infamous white paper. the assimilation policy had largely been carried out...not in secret, but knowledge of it was need-to-know. an open secret, perhaps. the tools of assimilation changed with technology - there was a phase when the government tried to convert the indigenous people into farmers, and they would have nothing of it - but the goal of assimilation was left unmodified, from the 1700s right up to the 1960s. what trudeau aimed to do was go public with it, and make it official policy; he wanted the indigenous groups to understand what was happening and take some control over it, themselves. that was in trudeau's direct democracy phase. as a reaction to the backlash, the liberal government of the time just shut the file down and carried on with the same assimilation policy, quietly, as it always had before. there were blood quantum rules introduced in the 80s, and by the 00s harper was threatening them with property rights (which make no sense in indigenous culture). the idea for decades has been to starve them of funds and create poor conditions to try and convince them to move away from the reserves, while paying lip service to funding increases that never come. but, it doesn't seem to be working - because they don't have the resources to leave.
it doesn't make sense to build cities in the middle of nowhere. so, they should be offered modern housing elsewhere, but not moved - let them freely make the choice to move away.
and, some won't. but, they'll need to get used to living on the edges of civilization, and the lack of comfort inherent within it.
http://www.huffingtonpost.ca/2018/01/19/trudeau-promises-to-help-first-nation-reserve-with-housing-shortage_a_23338560/
jagmeet singh must cut his beard.
there are no roads into this community, which has to deal with frozen ground for a substantial amount of the year. it's surrounded by marshes and wetlands, with little agricultural support and no meaningful industry, except perhaps logging. i don't think there are mines in the wetlands of northwestern ontario, although there are quite a few to the south and to the east.
i want the natives to have access to modern amenities. but, their request amounts to building them a city that has no potential economic base. it doesn't matter what you put into a community like this, if it is so poorly geographically positioned that it has no economy. imports into the city are going to need to be expensive, because it is so far removed from existing infrastructure. so, the only way the city would be able to survive and grow would be through increasingly large government subsidies. it doesn't make any sense to walk down this path, and so no government will actually do it.
i think it's worth acknowledging that the low quality of the land in the reserve is the reason that it was put aside for indigenous people, who were then rounded up from the outlying areas and placed in it. nothing could grow here, anyways, so it's of no loss to put the indigenous people there. now, we are faced with the absurd consequences of an unjust policy, the building of an isolated city in the marshland wilderness, and need to re-examine it from the core.
i think that if the trudeau government, or any government, is serious about housing in remote reserves, it needs to lay it out for these people: there will never be running water or sewer systems or stable electricity in these regions, because it makes no sense to build cities where there is no potential for economic activity. governments should nonetheless commit and strive towards moving these people into modern housing in serviceable areas, which may mean indigenous neighbourhoods in semi-rural or suburban areas, but not these remote villages in virtually uninhabitable places.
the government says things to win votes. if it were serious, it would stop the charade. and, as long as the charade continues, it should be seen as disingenuous.
the government's assimilation policy is as old as the country. what i'm suggesting is actually not dissimilar to what the elder trudeau, and his sidekick, chretien, tried to do in the infamous white paper. the assimilation policy had largely been carried out...not in secret, but knowledge of it was need-to-know. an open secret, perhaps. the tools of assimilation changed with technology - there was a phase when the government tried to convert the indigenous people into farmers, and they would have nothing of it - but the goal of assimilation was left unmodified, from the 1700s right up to the 1960s. what trudeau aimed to do was go public with it, and make it official policy; he wanted the indigenous groups to understand what was happening and take some control over it, themselves. that was in trudeau's direct democracy phase. as a reaction to the backlash, the liberal government of the time just shut the file down and carried on with the same assimilation policy, quietly, as it always had before. there were blood quantum rules introduced in the 80s, and by the 00s harper was threatening them with property rights (which make no sense in indigenous culture). the idea for decades has been to starve them of funds and create poor conditions to try and convince them to move away from the reserves, while paying lip service to funding increases that never come. but, it doesn't seem to be working - because they don't have the resources to leave.
it doesn't make sense to build cities in the middle of nowhere. so, they should be offered modern housing elsewhere, but not moved - let them freely make the choice to move away.
and, some won't. but, they'll need to get used to living on the edges of civilization, and the lack of comfort inherent within it.
http://www.huffingtonpost.ca/2018/01/19/trudeau-promises-to-help-first-nation-reserve-with-housing-shortage_a_23338560/
jagmeet singh must cut his beard.
at
02:04
Saturday, January 20, 2018
so, what's with russia and turkey, anyways?
well, they've fought wars in the historical period, and not just geographic skirmishes, but deep cultural wars that featured wild card barbarian groups that would take the side of one religion or the other. but, as is so often the case, these deep wars were really actually civil in conflict, as the russians and turks truly represented opposing views in a deep civil war over control of the roman empire, which had long reverted to a greek empire. it's an intra-hellenic conflict.
if you were to map out the areas under the direct control of the actual influence of greek civilization, rather than it's romanized abstraction, it would include both the areas under historical byzantine control and the areas under the control of the orthodox church. broadly speaking, that is the areas in the russian and ottoman empires, with lost colonies along the mediterranean coast, from magna graecia through france and into spain.
historians acknowledge this privately, but seem weird about publishing it: the ottoman empire was really just the reconstruction of the byzantine empire, under a cultural shift to a new religious order, which was maybe even a little more liberal than the previous one, in some ways. there was a population replacement to accompany the shift in religious order, but the empire ultimately survived, albeit under a new ruling class. it should be thought of as a revolution in the empire, then, and not the end of history that the christian byzantines believed that it would be.
it's amazing how that myth - that the fall of constantinople would be the end of history, as jesus would return - has, itself, persisted through the centuries, to continue to colour how we view the events of 1453. this was a revolution, and yet we call it the fall of a civilization - or the beginning of a new one, depending on your perspective. but, the truth seems to rather be continuity in the empire itself - that the hard-headed constantinople, clinging to the past, was finally brought in line with the changes that had already occurred through the rest of the empire. nor did byzantine civilization truly fall, as it was exported to russia, where it carried on; the byzantines lost their empire, but then quickly built a new one.
if there is any process in history, it should lead to these halves of the same civilization re-uniting as the cultural forces that ripped them apart dissipate into history. but, are the societies of turkey and russia ready to move forwards as a new empire - not just politically, but culturally? not for a generation, at least.
the partition of the eastern empire into russian and turkish halves is something that took place over centuries, and is complicated by the absorption and expulsion of a third empire, that of the persians. the initial split happened during the arab expansion, which both led to the toppling of the persian state and to the seizure of much of the eastern mediterranean coast. but, this itself was only possible because the romans were in the process of actually annexing the persians; if accomplished, this would have geographically been a return to the achaemenid empire. it was the persians who were conquering the byzantines from the inside out. the persian empire itself was split by the campaigns of alexander, but continued to exist in a loose federation of hellenic states. this was itself a revolution, from persian to greek cultural norms. - but the empire survived it. the romans presented the next outside and existential threat to the empire, but, by the time of the arab invasions, a thousand years after the romans fought carthage, the empire was finally about to absorb them. what is it to be an empire without an existential threat? but, the arabs were absorbed far more easily than the romans, and it was in truth a new persian empire that spread outwards from the middle east at that time.
the next threat to the persian empire came from the devastating mongol invasions, which left wide swaths of destruction and virtual depopulation in some areas. this was the closest that the persian empire, the cultural continuation of both mesopotamian and greek civilization as well as the inheritor of arab religion, came to actual destruction. institutions throughout the empire ceased to exist, forcing the empire to retreat to the iranian plateau, leaving the majority of the geographic empire in anarchy. the persian empire has truly not recovered from this devastation that happened in the thirteenth century, although it is as close to recovering today as it ever has been.
the turks were the group that eventually re-imposed order in the western part of the persian empire, but they did so by taking control of byzantine institutions and converting them into instruments of their own power. the rise of turkish power should consequently be seen as a counter-revolution of the greco-roman empire against the arab/persian empire, even if it adopted the religion of the latter. and, so, what we see by the end of the sixteenth century is a new greco-roman-turkic empire on the eastern side of europe.
the empire survived, when it's culture did not.
it's culture, meanwhile, fled to moscow - along with aristocrats and clergy. russian expansion began in 1463. eventually, the ruler of russia became the new tsar - that is the new caesar, the new emperor. there were sufficient byzantine bloodlines in the russian ruling class for the western emperor to acknowledge the russian emperor as caesar as early as 1514.
the russians and turks fought their first war from 1568-1570 and their last from 1914-1918, leaving the civil war in a state without resolution, and the southern partition under threat of reabsorption from the western empire, which is on the brink of moving it's capital from london to washington.
i've said this before: if there is any process in history, the eastern emperor will return to constantinople, in time.
jagmeet singh must cut his beard.
well, they've fought wars in the historical period, and not just geographic skirmishes, but deep cultural wars that featured wild card barbarian groups that would take the side of one religion or the other. but, as is so often the case, these deep wars were really actually civil in conflict, as the russians and turks truly represented opposing views in a deep civil war over control of the roman empire, which had long reverted to a greek empire. it's an intra-hellenic conflict.
if you were to map out the areas under the direct control of the actual influence of greek civilization, rather than it's romanized abstraction, it would include both the areas under historical byzantine control and the areas under the control of the orthodox church. broadly speaking, that is the areas in the russian and ottoman empires, with lost colonies along the mediterranean coast, from magna graecia through france and into spain.
historians acknowledge this privately, but seem weird about publishing it: the ottoman empire was really just the reconstruction of the byzantine empire, under a cultural shift to a new religious order, which was maybe even a little more liberal than the previous one, in some ways. there was a population replacement to accompany the shift in religious order, but the empire ultimately survived, albeit under a new ruling class. it should be thought of as a revolution in the empire, then, and not the end of history that the christian byzantines believed that it would be.
it's amazing how that myth - that the fall of constantinople would be the end of history, as jesus would return - has, itself, persisted through the centuries, to continue to colour how we view the events of 1453. this was a revolution, and yet we call it the fall of a civilization - or the beginning of a new one, depending on your perspective. but, the truth seems to rather be continuity in the empire itself - that the hard-headed constantinople, clinging to the past, was finally brought in line with the changes that had already occurred through the rest of the empire. nor did byzantine civilization truly fall, as it was exported to russia, where it carried on; the byzantines lost their empire, but then quickly built a new one.
if there is any process in history, it should lead to these halves of the same civilization re-uniting as the cultural forces that ripped them apart dissipate into history. but, are the societies of turkey and russia ready to move forwards as a new empire - not just politically, but culturally? not for a generation, at least.
the partition of the eastern empire into russian and turkish halves is something that took place over centuries, and is complicated by the absorption and expulsion of a third empire, that of the persians. the initial split happened during the arab expansion, which both led to the toppling of the persian state and to the seizure of much of the eastern mediterranean coast. but, this itself was only possible because the romans were in the process of actually annexing the persians; if accomplished, this would have geographically been a return to the achaemenid empire. it was the persians who were conquering the byzantines from the inside out. the persian empire itself was split by the campaigns of alexander, but continued to exist in a loose federation of hellenic states. this was itself a revolution, from persian to greek cultural norms. - but the empire survived it. the romans presented the next outside and existential threat to the empire, but, by the time of the arab invasions, a thousand years after the romans fought carthage, the empire was finally about to absorb them. what is it to be an empire without an existential threat? but, the arabs were absorbed far more easily than the romans, and it was in truth a new persian empire that spread outwards from the middle east at that time.
the next threat to the persian empire came from the devastating mongol invasions, which left wide swaths of destruction and virtual depopulation in some areas. this was the closest that the persian empire, the cultural continuation of both mesopotamian and greek civilization as well as the inheritor of arab religion, came to actual destruction. institutions throughout the empire ceased to exist, forcing the empire to retreat to the iranian plateau, leaving the majority of the geographic empire in anarchy. the persian empire has truly not recovered from this devastation that happened in the thirteenth century, although it is as close to recovering today as it ever has been.
the turks were the group that eventually re-imposed order in the western part of the persian empire, but they did so by taking control of byzantine institutions and converting them into instruments of their own power. the rise of turkish power should consequently be seen as a counter-revolution of the greco-roman empire against the arab/persian empire, even if it adopted the religion of the latter. and, so, what we see by the end of the sixteenth century is a new greco-roman-turkic empire on the eastern side of europe.
the empire survived, when it's culture did not.
it's culture, meanwhile, fled to moscow - along with aristocrats and clergy. russian expansion began in 1463. eventually, the ruler of russia became the new tsar - that is the new caesar, the new emperor. there were sufficient byzantine bloodlines in the russian ruling class for the western emperor to acknowledge the russian emperor as caesar as early as 1514.
the russians and turks fought their first war from 1568-1570 and their last from 1914-1918, leaving the civil war in a state without resolution, and the southern partition under threat of reabsorption from the western empire, which is on the brink of moving it's capital from london to washington.
i've said this before: if there is any process in history, the eastern emperor will return to constantinople, in time.
jagmeet singh must cut his beard.
at
22:39
i guess i don't like the idea of presenting the situation as a choice between public funding and crowd-sourcing, as i think the better idea is to use them together: crowd-sourcing cannot replace the state in terms of resource allocation, but that doesn't mean it might not be useful to fund certain kinds of research that the government might fear political repercussions around, or might not fund due to corporate capture. for small fundraising purposes, it might be easier to crowdsource than to agitate, but i would dissuade people from disengaging from agitating for further public funds; this can't be a solution to that problem.
in this particular situation, though, i might suggest that a guaranteed annual income might be what would most benefit this researcher, as it would narrow the field of candidates down to the ones that have an engaged interest in the topic. conversely, this is a good example of how i'd imagine a gai would work: people would be freer to participate in their intellectual pursuits, be they in the arts or the sciences or whatever else.
http://www.cbc.ca/news/health/second-opinion-crowdfund-science-research-1.4495632
jagmeet singh must cut his beard.
in this particular situation, though, i might suggest that a guaranteed annual income might be what would most benefit this researcher, as it would narrow the field of candidates down to the ones that have an engaged interest in the topic. conversely, this is a good example of how i'd imagine a gai would work: people would be freer to participate in their intellectual pursuits, be they in the arts or the sciences or whatever else.
http://www.cbc.ca/news/health/second-opinion-crowdfund-science-research-1.4495632
jagmeet singh must cut his beard.
at
15:17
so, who is this guy, erdogan, anyways?
well, like russia, turkey is in theory subject to periodic elections to change power, although the elections in turkey are somewhat of a joke, due as much to a disproportionate amount of power invested in the rural regions as due to endemic state corruption. like putin, erdogan would have probably won every election he's fought in without cheating, but that doesn't mean they didn't cheat, anyways, just to demonstrate they were in charge. i mean, if you can't rig the election, you're not really in power, right?
so, one way or another, he might not be around too much longer. but, the turkey he's going to leave behind no doubt will be.
now, don't misunderstand my conclusion, here. erdogan is a wily character, no doubt. there was a strange tradition in turkey recently, although i suppose it has it's roots in the iconoclast controversy, where the military would allow elections so long as the outcome remained a secular government, and launch a coup if the government was seen to be carrying forward any kind of islamicization. excuses about the first world war aside, what istanbul really feared was influence from mecca, and then from riyadh - it sought to separate the population from a millennia of history as a muslim province, much of it with illegitimate power as a usurped colonial force from the previous era, and instead assert a concept of turkish nationalism. for, it realized that the combined arab countries that it had colonized for so long were now a direct threat to it, should it conform too heavily to the culture in those states. it had to limit the influence of islam to avoid being absorbed by it.
whether these fears remained valid through the rise of arab socialism is questionable, but the tradition remained in place, nonetheless. upon first taking office, there was every reason to assume that the military would effortlessly remove erdogan should he work towards this goal.
but, erdogan did what no turkish leader had done before him - he reformed the military culture by purging officials thought to be capable or interested in carrying out a coup and replacing them with loyalists. so, when the united states agitated for a coup to replace him, it was unable to do so effectively. that arguably makes him the first fully independent turkish leader since ataturk.
a turkish declaration of independence from nato would have dramatic shifts in the global power balance, simply due to the fact that they would immediately become a regional power. i would not expect the turks to immediately end co-operation with nato, but increased co-operation with russia could neutralize significant strategic advantages that nato has in both the black sea and the baltic regions. and, of course, nato would lose a large, modern, capable standing army, even if it doesn't defect anywhere particular immediately.
so, erdogan was wily enough to change the structure of the state in such a way that he could not be removed in a coup. that's in some ways impressive. and, he seems to have the resources to do sneaky things in the regions directly around his borders to advance his country's own interests. the history is complicated, but, rather than fear russia today, he no doubt believes that turkey could eclipse russia in economic union, and ultimately become the dominant partner in a counter-european axis - an error that is hitleresque in potential scope. wily leaders are in truth best met with checks and balances.
but, while erdogan is wily at home, he is not so wily as putin is when it comes to foreign policy. he does not have the grasp on the games being played, does not have the grasp of tactics or strategy and frankly doesn't have access to the same resources, either in intelligence or in academia.
the empire is right to treat him as a dumb barbarian that can be easily manipulated through hot-headed outbursts of emotion.
jagmeet singh must cut his beard,
well, like russia, turkey is in theory subject to periodic elections to change power, although the elections in turkey are somewhat of a joke, due as much to a disproportionate amount of power invested in the rural regions as due to endemic state corruption. like putin, erdogan would have probably won every election he's fought in without cheating, but that doesn't mean they didn't cheat, anyways, just to demonstrate they were in charge. i mean, if you can't rig the election, you're not really in power, right?
so, one way or another, he might not be around too much longer. but, the turkey he's going to leave behind no doubt will be.
now, don't misunderstand my conclusion, here. erdogan is a wily character, no doubt. there was a strange tradition in turkey recently, although i suppose it has it's roots in the iconoclast controversy, where the military would allow elections so long as the outcome remained a secular government, and launch a coup if the government was seen to be carrying forward any kind of islamicization. excuses about the first world war aside, what istanbul really feared was influence from mecca, and then from riyadh - it sought to separate the population from a millennia of history as a muslim province, much of it with illegitimate power as a usurped colonial force from the previous era, and instead assert a concept of turkish nationalism. for, it realized that the combined arab countries that it had colonized for so long were now a direct threat to it, should it conform too heavily to the culture in those states. it had to limit the influence of islam to avoid being absorbed by it.
whether these fears remained valid through the rise of arab socialism is questionable, but the tradition remained in place, nonetheless. upon first taking office, there was every reason to assume that the military would effortlessly remove erdogan should he work towards this goal.
but, erdogan did what no turkish leader had done before him - he reformed the military culture by purging officials thought to be capable or interested in carrying out a coup and replacing them with loyalists. so, when the united states agitated for a coup to replace him, it was unable to do so effectively. that arguably makes him the first fully independent turkish leader since ataturk.
a turkish declaration of independence from nato would have dramatic shifts in the global power balance, simply due to the fact that they would immediately become a regional power. i would not expect the turks to immediately end co-operation with nato, but increased co-operation with russia could neutralize significant strategic advantages that nato has in both the black sea and the baltic regions. and, of course, nato would lose a large, modern, capable standing army, even if it doesn't defect anywhere particular immediately.
so, erdogan was wily enough to change the structure of the state in such a way that he could not be removed in a coup. that's in some ways impressive. and, he seems to have the resources to do sneaky things in the regions directly around his borders to advance his country's own interests. the history is complicated, but, rather than fear russia today, he no doubt believes that turkey could eclipse russia in economic union, and ultimately become the dominant partner in a counter-european axis - an error that is hitleresque in potential scope. wily leaders are in truth best met with checks and balances.
but, while erdogan is wily at home, he is not so wily as putin is when it comes to foreign policy. he does not have the grasp on the games being played, does not have the grasp of tactics or strategy and frankly doesn't have access to the same resources, either in intelligence or in academia.
the empire is right to treat him as a dumb barbarian that can be easily manipulated through hot-headed outbursts of emotion.
jagmeet singh must cut his beard,
at
06:18
in addition to not being invited to bring troops in to syria, america was not invited to the peace talks in astana - and is not invited to help with reconstruction. america will be shut out from those contracts, which will go to russian and chinese firms. the announcement was merely meant to save face, as so many announcements about syria and iran are. the 2015 nuclear deal was about saving face; maybe what i've been saying for years about that is that much more clear, now.
but, why would america do this? is this just daft, as is suggested here?
tillerson doesn't make these choices, of course. he's reading a script (and sounds like it). these decisions come from inside the establishment that trump has chosen not to turn over. it's the same policy people from the obama admin..
turkey is in nato, but nato is losing turkey to russian influence. nato is also losing the kurds. now, it's not like the kurds can actually fight a war against the turks; they can carry out acts of resistance, but there was no kurdistan on the map, last i checked, and it is for that reason: the kurds have no chance against the turks..this would not be a war, but a slaughter.
why is turkey in nato? because it feared soviet expansion. today, turkey fears saudi expansion, and it is russia that is best positioned to counter-balance it. further, turkey has been poorly integrated into the european side of globalization, forcing it to look to asia for partners. there are no serious economic incentives for turkey to remain in nato, right now, and rather strong incentives to decouple. so, if no action is taken, nato is likely to lose turkey to russian influence.
given that truth, it is in america's interest to generate a conflict between russia and turkey. should the turks refuse to return sovereignty to the syrians, that is likely to create a conflict between the russians and turks. if the kurds are enough of a nuisance, the turks might decide they're not leaving. and, are the russians going to scold them for annexing syrian kurdistan? the turks wouldn't annex, they'd occupy, but you get the point.
but, that is indeed the miscalculation. as, such an occupation would actually serve russian interests, in creating a buffer zone of turkish militarization around their own bases, which are the focal point of the conflict.
this is what america does. because it is the empire. but, it's not always the best at it.
jagmeet singh must cut his beard.
but, why would america do this? is this just daft, as is suggested here?
tillerson doesn't make these choices, of course. he's reading a script (and sounds like it). these decisions come from inside the establishment that trump has chosen not to turn over. it's the same policy people from the obama admin..
turkey is in nato, but nato is losing turkey to russian influence. nato is also losing the kurds. now, it's not like the kurds can actually fight a war against the turks; they can carry out acts of resistance, but there was no kurdistan on the map, last i checked, and it is for that reason: the kurds have no chance against the turks..this would not be a war, but a slaughter.
why is turkey in nato? because it feared soviet expansion. today, turkey fears saudi expansion, and it is russia that is best positioned to counter-balance it. further, turkey has been poorly integrated into the european side of globalization, forcing it to look to asia for partners. there are no serious economic incentives for turkey to remain in nato, right now, and rather strong incentives to decouple. so, if no action is taken, nato is likely to lose turkey to russian influence.
given that truth, it is in america's interest to generate a conflict between russia and turkey. should the turks refuse to return sovereignty to the syrians, that is likely to create a conflict between the russians and turks. if the kurds are enough of a nuisance, the turks might decide they're not leaving. and, are the russians going to scold them for annexing syrian kurdistan? the turks wouldn't annex, they'd occupy, but you get the point.
but, that is indeed the miscalculation. as, such an occupation would actually serve russian interests, in creating a buffer zone of turkish militarization around their own bases, which are the focal point of the conflict.
this is what america does. because it is the empire. but, it's not always the best at it.
jagmeet singh must cut his beard.
at
05:00
Friday, January 19, 2018
i'm going to vote for noise, right now.
the conservatives are running near the high end of their error bar, but it's normal to inflate conservative support a little bit in the numbers - it's a sampling bias and everybody knows it. i've repeatedly presented the number of 30% as a workable zero for conservative support, and it's been hovering near there, now, for years. is 32%, 33% conservative support believable? well, that's still absurdly low, really. but the difference between 34 and 30 on a single poll is negligible, given the importance of that number 30. that's noise. it's going to have to stay put a while to be believable.
the liberals are running around historically normal levels, which is about 40%, maybe just under it. again, 37% is at the bottom of the error bar, but, right now, it's just noise.
...except that something that looks to be a little bit more convincing is a steady uptick in ndp support. the noise in the conservative numbers could be underestimating the distance between the conservatives and the liberals, and presenting a false deduction regarding the lower liberal numbers, which are really bleeding to the ndp.
the other option is that they're bleeding on both sides. but that doesn't seem to be consistent with the data, which is presenting a gap in popularity between the conservative party and it's leader. so, i'm going to vote for noise in the conservative data, for right now - and maybe a signal with the ndp.
http://www.nanosresearch.com/tickers/PDF/20180112%20Political%20Package%20Eng.pdf
jagmeet singh must cut his beard.
the conservatives are running near the high end of their error bar, but it's normal to inflate conservative support a little bit in the numbers - it's a sampling bias and everybody knows it. i've repeatedly presented the number of 30% as a workable zero for conservative support, and it's been hovering near there, now, for years. is 32%, 33% conservative support believable? well, that's still absurdly low, really. but the difference between 34 and 30 on a single poll is negligible, given the importance of that number 30. that's noise. it's going to have to stay put a while to be believable.
the liberals are running around historically normal levels, which is about 40%, maybe just under it. again, 37% is at the bottom of the error bar, but, right now, it's just noise.
...except that something that looks to be a little bit more convincing is a steady uptick in ndp support. the noise in the conservative numbers could be underestimating the distance between the conservatives and the liberals, and presenting a false deduction regarding the lower liberal numbers, which are really bleeding to the ndp.
the other option is that they're bleeding on both sides. but that doesn't seem to be consistent with the data, which is presenting a gap in popularity between the conservative party and it's leader. so, i'm going to vote for noise in the conservative data, for right now - and maybe a signal with the ndp.
http://www.nanosresearch.com/tickers/PDF/20180112%20Political%20Package%20Eng.pdf
jagmeet singh must cut his beard.
at
01:15
Thursday, January 18, 2018
i'm actually kind of aghast at the hypocrisy i'm hearing from defenders of aziz ansari.
but, maybe the hypocrisy is exposing what #metoo is really about, which is a violent enforcement of a diversity strategy rather than a vigilante lynch mob. it seems like it was never about what these men did or didn't do, and more about perceived injustices in how they obtained their positions of power given the intersection of their gender and skin colours.
here is the reality of #metoo: if azis ansari were a white man, he'd be torn down as fast as the next one. but, he's getting a pass on this because he's not white, because the oppressor in the narrative is supposed to be a white male. it's a weird twist: he's being rejected for the role of villain due to his race. whites only.
....because that's what this is really about, and why it doesn't matter if the accusations are true or not, so long as the people falling are white men from positions of perceived privilege.
jagmeet singh must cut his beard
but, maybe the hypocrisy is exposing what #metoo is really about, which is a violent enforcement of a diversity strategy rather than a vigilante lynch mob. it seems like it was never about what these men did or didn't do, and more about perceived injustices in how they obtained their positions of power given the intersection of their gender and skin colours.
here is the reality of #metoo: if azis ansari were a white man, he'd be torn down as fast as the next one. but, he's getting a pass on this because he's not white, because the oppressor in the narrative is supposed to be a white male. it's a weird twist: he's being rejected for the role of villain due to his race. whites only.
....because that's what this is really about, and why it doesn't matter if the accusations are true or not, so long as the people falling are white men from positions of perceived privilege.
jagmeet singh must cut his beard
at
16:56
it's a rather entitled view from john robson, who seems to think that taxpayers have some obligation to fund groups that are promoting visions that are antithetical to existing society. this is the construction of some kind of positive right to religion, and the fabrication of a duty of the crown to nurture it.
certainly, these groups have every right to continue to flounder into irrelevance, as they promote a message that nobody wants to hear. they can yell at the trees all they want. but, just not with public money.
it's true that the charter doesn't explicitly protect for abortion, but the argument that struck down abortion was fundamentally about access at demand, actually, yes. it was found that a ministerial system of approval was resulting in delays that were affecting women's choices, and that the system needed to be altered to provide for greater access. this was fundamentally about striking down the idea that government ought to be making choices for women and asserting the idea that women ought to be able to make those choices for themselves. so, any system that would restrict access at any level of effectiveness would indeed be a charter breach, based on case law around the right to security of the person. while it's not a direct right in the charter, trudeau is actually correct that the existing precedent would clearly be to treat abortion as though it is, as a construction of s. 7.
but, you see the same error in these concepts of freedom of expression across the right of the spectrum, don't you? they don't have any grasp of a reality where they're actually being suppressed, so they attach this entitlement to being heard. but, freedom of expression is not the right to be heard, it is only the right to speak. trudeau has done nothing here to infringe on this. he's merely updated the policy to reflect the existing social norms.
i hope he remains consistent in his policies around this.
http://nationalpost.com/opinion/john-robson-trudeau-defies-the-truth-with-nonsense-as-effortlessly-as-trump
jagmeet singh must cut his beard.
certainly, these groups have every right to continue to flounder into irrelevance, as they promote a message that nobody wants to hear. they can yell at the trees all they want. but, just not with public money.
it's true that the charter doesn't explicitly protect for abortion, but the argument that struck down abortion was fundamentally about access at demand, actually, yes. it was found that a ministerial system of approval was resulting in delays that were affecting women's choices, and that the system needed to be altered to provide for greater access. this was fundamentally about striking down the idea that government ought to be making choices for women and asserting the idea that women ought to be able to make those choices for themselves. so, any system that would restrict access at any level of effectiveness would indeed be a charter breach, based on case law around the right to security of the person. while it's not a direct right in the charter, trudeau is actually correct that the existing precedent would clearly be to treat abortion as though it is, as a construction of s. 7.
but, you see the same error in these concepts of freedom of expression across the right of the spectrum, don't you? they don't have any grasp of a reality where they're actually being suppressed, so they attach this entitlement to being heard. but, freedom of expression is not the right to be heard, it is only the right to speak. trudeau has done nothing here to infringe on this. he's merely updated the policy to reflect the existing social norms.
i hope he remains consistent in his policies around this.
http://nationalpost.com/opinion/john-robson-trudeau-defies-the-truth-with-nonsense-as-effortlessly-as-trump
jagmeet singh must cut his beard.
at
15:05
ok, so i've got the facebook pages updated. i'm going to ultimately convert that timeline into something hardcoded, so i'm actually really using it for data redundancy. but, if you want, you can scroll all the way back to 1996 and see a detailed time-based presentation of my first two periods.
https://www.facebook.com/pg/jessicaambermurray/
there's a condensed version mirrored at my personal facebook site, as well.
i need to close the last bunch of releases for the vlog before i can get back to the alter-reality, but first i need to eat...
i've decided that i need to approach the master list a bit more cumulatively to start. so, i should just get right to reading what was written over 1996, and writing 1997 and planning out 1998. i can get to filling the rest in once that's been taken care of.
jagmeet singh must cut his beard.
https://www.facebook.com/pg/jessicaambermurray/
there's a condensed version mirrored at my personal facebook site, as well.
i need to close the last bunch of releases for the vlog before i can get back to the alter-reality, but first i need to eat...
i've decided that i need to approach the master list a bit more cumulatively to start. so, i should just get right to reading what was written over 1996, and writing 1997 and planning out 1998. i can get to filling the rest in once that's been taken care of.
jagmeet singh must cut his beard.
at
01:24
Wednesday, January 17, 2018
actually, i think the accusations against aziz ansari are a lot worse than those against al franken or louis ck, to begin with. and, they strike me as more credible, too.
consent needs to be overwhelming. no means no. yes means yes. neither means no. and, you shouldn't have to say it twice. staying in the house does not mean yes, and is not an invitation; she made what she wanted clear, and he continued to advance, and quite physically at that. if true, that is assault, by any definition of it.
the place i push back at is when somebody says yes, and then claims they were coerced or in the submissive side of a power relationship, and they really didn't mean it but they had no choice. duress is one thing. but, if all of the proper procedures are followed to ensure consent, how can any one claim a guilty mind? according to the accuser, she said no, and ansari kept at it anyways.
i'm not in the position to hear all of the evidence, but if an accuser is set to bring a case forward, than ansarii should be tried accordingly.
jagmeet singh must cut his beard.
consent needs to be overwhelming. no means no. yes means yes. neither means no. and, you shouldn't have to say it twice. staying in the house does not mean yes, and is not an invitation; she made what she wanted clear, and he continued to advance, and quite physically at that. if true, that is assault, by any definition of it.
the place i push back at is when somebody says yes, and then claims they were coerced or in the submissive side of a power relationship, and they really didn't mean it but they had no choice. duress is one thing. but, if all of the proper procedures are followed to ensure consent, how can any one claim a guilty mind? according to the accuser, she said no, and ansari kept at it anyways.
i'm not in the position to hear all of the evidence, but if an accuser is set to bring a case forward, than ansarii should be tried accordingly.
jagmeet singh must cut his beard.
at
23:01
see, you have to wonder if they picked the wrong stream here on purpose.
should melting waters fuck with the jet stream? well, they're in completely different layers of the earth's structure, and thereby part of completely different systems. you'd have to come up with some way as to how.
but, should melting waters fuck with the gulf stream? well, yeah. fucking right they should. that would piss the brits off, i bet.
you'd have to point out that the oceans in the gulf are warming though, so it's a question of where a new equilibrium falls, as the oceans shift around and make sense of the new normal, whenever that itself arrives.
but, none of that should really have much of an affect on the jet stream. not by the way i understand how things work, anyways.
https://www.washingtonpost.com/news/energy-environment/wp/2015/03/12/first-it-was-crazy-winters-now-global-warming-may-also-be-driving-crazy-summers/
jagmeet singh must cut his beard.
should melting waters fuck with the jet stream? well, they're in completely different layers of the earth's structure, and thereby part of completely different systems. you'd have to come up with some way as to how.
but, should melting waters fuck with the gulf stream? well, yeah. fucking right they should. that would piss the brits off, i bet.
you'd have to point out that the oceans in the gulf are warming though, so it's a question of where a new equilibrium falls, as the oceans shift around and make sense of the new normal, whenever that itself arrives.
but, none of that should really have much of an affect on the jet stream. not by the way i understand how things work, anyways.
https://www.washingtonpost.com/news/energy-environment/wp/2015/03/12/first-it-was-crazy-winters-now-global-warming-may-also-be-driving-crazy-summers/
jagmeet singh must cut his beard.
at
16:56
i plugged my router back in this morning, and it's made an instant difference in speeding up my machine. i had it unplugged because i didn't want to break the network architecture in the old apartment, but now it doesn't matter any more, because i have to rebuild it anyways.
it's facebook, mostly, that's the problem. i'm guessing that, even with adblock, all of the scripts running are just killing the dns, when it's external. pulling the dns down into the router seems to make a massive difference in responsiveness. that's really crazy, actually. for all of the talk of facebook's influence on elections, it seems to have tied itself to the same generation that is in the process of slowly eroding power, while making it unattractive to younger people. and, these slow pages, if they're widely experienced, are going to just add to the problem.
so, i should be a bit more productive today, as i won't be waiting for pages to load. what i'm doing is distributing the last batch of uploads over facebook, which will be a part of building the master list, soon.
jagmeet singh must cut his beard.
it's facebook, mostly, that's the problem. i'm guessing that, even with adblock, all of the scripts running are just killing the dns, when it's external. pulling the dns down into the router seems to make a massive difference in responsiveness. that's really crazy, actually. for all of the talk of facebook's influence on elections, it seems to have tied itself to the same generation that is in the process of slowly eroding power, while making it unattractive to younger people. and, these slow pages, if they're widely experienced, are going to just add to the problem.
so, i should be a bit more productive today, as i won't be waiting for pages to load. what i'm doing is distributing the last batch of uploads over facebook, which will be a part of building the master list, soon.
jagmeet singh must cut his beard.
at
09:32
no, seriously.
do, you know what ontario should actually do with it's marijuana legalization plan, and the process it's devising to put customers through to purchase the product?
it should sell it to universal studios. because that's what it is - it's an amusement park exhibition for a film studio. but, it's maybe a new kind of amusement ride, it's one based on augmented reality - they will let you live through the process of carrying out a drug deal on camera. it should come with a few stunts, too - maybe an attempt by a rival government to break in and steal their stash. i think it was robert newman that predicted that the new reserve currency would be hashish.
has anybody really looked at this? this is crazy. they can't actually be serious about how they're claiming they're doing this.....
jagmeet singh must cut his beard.
do, you know what ontario should actually do with it's marijuana legalization plan, and the process it's devising to put customers through to purchase the product?
it should sell it to universal studios. because that's what it is - it's an amusement park exhibition for a film studio. but, it's maybe a new kind of amusement ride, it's one based on augmented reality - they will let you live through the process of carrying out a drug deal on camera. it should come with a few stunts, too - maybe an attempt by a rival government to break in and steal their stash. i think it was robert newman that predicted that the new reserve currency would be hashish.
has anybody really looked at this? this is crazy. they can't actually be serious about how they're claiming they're doing this.....
jagmeet singh must cut his beard.
at
09:14
Tuesday, January 16, 2018
so, what's with this korean war reunion going on in vancouver?
i hear luxembourg is slated to attend.
canada just got snuffed very badly by china; state-run media went so far as to label us a puppet of the united states. there's a certain thought process in the theory of canadian foreign policy that canada needs to maintain a counterbalance to american dominance, to avoid being absorbed. this counterbalance was historically occupied by the british, but this started to wane after world war two. there was some effort to approach both asia and latin america in the 70s before this idea lost popularity and we signed on to nafta in the 80s and 90s. but, with nafta unclear, and china rising, the old theory came back again, although it was actually stephen harper that put it back in motion by playing a dangerous game with the united states on oil exports. but, this snuff was deep enough that any thought of relying on china as a counterbalance to the united states was snuffed out with it - the chinese have really stated, in no uncertain terms, that they accept america's sphere of influence and that canada is in it. such overtures will not be reciprocated, but they send a clear enough message.
maybe we can send chrystia freeland to moscow to talk to the russians?
no. the counterbalance theory has no feasible balance save europe, which is no balance at the moment at all. so, the only option is to cuddle up with the elephant.
i don't expect canada to attempt to play peacemaker at this conference. our foreign policy people are aware that the threat of war is unlikely. rather, i expect that the purpose of the meeting is to remind america that canada fought along side it in korea. because we are the bestest of allies.
we're such good allies that we should have a good trade deal.
jagmeet singh must cut his beard
i hear luxembourg is slated to attend.
canada just got snuffed very badly by china; state-run media went so far as to label us a puppet of the united states. there's a certain thought process in the theory of canadian foreign policy that canada needs to maintain a counterbalance to american dominance, to avoid being absorbed. this counterbalance was historically occupied by the british, but this started to wane after world war two. there was some effort to approach both asia and latin america in the 70s before this idea lost popularity and we signed on to nafta in the 80s and 90s. but, with nafta unclear, and china rising, the old theory came back again, although it was actually stephen harper that put it back in motion by playing a dangerous game with the united states on oil exports. but, this snuff was deep enough that any thought of relying on china as a counterbalance to the united states was snuffed out with it - the chinese have really stated, in no uncertain terms, that they accept america's sphere of influence and that canada is in it. such overtures will not be reciprocated, but they send a clear enough message.
maybe we can send chrystia freeland to moscow to talk to the russians?
no. the counterbalance theory has no feasible balance save europe, which is no balance at the moment at all. so, the only option is to cuddle up with the elephant.
i don't expect canada to attempt to play peacemaker at this conference. our foreign policy people are aware that the threat of war is unlikely. rather, i expect that the purpose of the meeting is to remind america that canada fought along side it in korea. because we are the bestest of allies.
we're such good allies that we should have a good trade deal.
jagmeet singh must cut his beard
at
05:13
to be clear - the idea with the extended high school is that non-specialized employees, like governments, would stop asking for university degrees, because the skills that they require would be encapsulated in the enhanced high school diploma, whatever it's called. so, less people would actually want to go to university. the smaller pool of people would then actually mostly be able to get jobs in the fields they actually study in, which would be directed somewhat by research demand.
a field that this would probably have a large impact on would be computer science. but, programming ought to be thought of like writing - it's something employers ought to be able to assume that just about anybody can do. of course, there are specialized writers, and there will be specialized programmers. but, it's becoming a day-to-day thing that random people doing mundane tasks are going to need to know how to do, and so those skills should be adapted into a basic curriculum and many tasks should be delegated to people that graduate from it.
another thing that i think should be brought down to a basic level is an understanding of statistics. this is currently taught in ridiculous ways at the first through third year levels at universities, where you have statistics classes designed for every kind of student, although it's really just to break the classes up. the number of people taking statistics at a university is enormous, really, enough that it should be considered a common knowledge, too. i think a lot of students may also benefit from learning the statistics before they pick a specialization, both to better understand what they're learning and to be less distracted by stats. i mean, that's an extra psych or economics or physics or biology course you can take a semester, if you're not taking stats. a deeper immersion into what you're actually studying....
and, sure, some management courses would be helpful, too, maybe for people that in the end find themselves working in a fast food or retail type environment. it would level the playing field for promotions. and, it might give people that wouldn't have ordinarily seen themselves in a business role learn skills that they can use in the future. hey, if we're to have neo-liberalism, we ought to have some education in how it works. see, the neo-liberals start by getting human nature completely wrong - they assume infinite greed - and then design systems where infinite greed is available to all. they had interest rates at 0% for years. you were supposed to borrow money. yet, nobody did, because nobody understood they were supposed to. go around and ask people "did you take advantage of the 0% interest rates?", and they'll look at you like you're on drugs (and maybe you are and that's ok.). if you want us to act like homo economicus, you need to teach us how; it's not innate, it's not our nature. and, that doesn't mean a brainwashing course in neo-liberal "philosophy", either. even if you don't agree with this system, it's still useful to understand a little bit about how this works.
some breathing fossil is going to suggest we bring back civics class. i can hear it, right now:
"brrring back civics classss!"
well, maybe not civics class, exactly. but, a course in how parliament operates might be useful in a country where the government is a large employer. and, it might ensure that we understand how our system actually works, so long as it exists.
that's just a few ideas for a two-four year extension of high school. it would probably make sense for it to be a separate school system; to maintain high school graduation as a thing, then go on to this next school, then probably get a job.
i just feel it's necessary to draw attention to the fact that there are two problems with access to the school system - not only is it prohibitively expensive but the situation of degree necessity has led to lower standards across the board. it makes more sense to split these kids out of the university system, and let it focus on people that are going to actually end up doing research.
jagmeet singh must cut his beard.
a field that this would probably have a large impact on would be computer science. but, programming ought to be thought of like writing - it's something employers ought to be able to assume that just about anybody can do. of course, there are specialized writers, and there will be specialized programmers. but, it's becoming a day-to-day thing that random people doing mundane tasks are going to need to know how to do, and so those skills should be adapted into a basic curriculum and many tasks should be delegated to people that graduate from it.
another thing that i think should be brought down to a basic level is an understanding of statistics. this is currently taught in ridiculous ways at the first through third year levels at universities, where you have statistics classes designed for every kind of student, although it's really just to break the classes up. the number of people taking statistics at a university is enormous, really, enough that it should be considered a common knowledge, too. i think a lot of students may also benefit from learning the statistics before they pick a specialization, both to better understand what they're learning and to be less distracted by stats. i mean, that's an extra psych or economics or physics or biology course you can take a semester, if you're not taking stats. a deeper immersion into what you're actually studying....
and, sure, some management courses would be helpful, too, maybe for people that in the end find themselves working in a fast food or retail type environment. it would level the playing field for promotions. and, it might give people that wouldn't have ordinarily seen themselves in a business role learn skills that they can use in the future. hey, if we're to have neo-liberalism, we ought to have some education in how it works. see, the neo-liberals start by getting human nature completely wrong - they assume infinite greed - and then design systems where infinite greed is available to all. they had interest rates at 0% for years. you were supposed to borrow money. yet, nobody did, because nobody understood they were supposed to. go around and ask people "did you take advantage of the 0% interest rates?", and they'll look at you like you're on drugs (and maybe you are and that's ok.). if you want us to act like homo economicus, you need to teach us how; it's not innate, it's not our nature. and, that doesn't mean a brainwashing course in neo-liberal "philosophy", either. even if you don't agree with this system, it's still useful to understand a little bit about how this works.
some breathing fossil is going to suggest we bring back civics class. i can hear it, right now:
"brrring back civics classss!"
well, maybe not civics class, exactly. but, a course in how parliament operates might be useful in a country where the government is a large employer. and, it might ensure that we understand how our system actually works, so long as it exists.
that's just a few ideas for a two-four year extension of high school. it would probably make sense for it to be a separate school system; to maintain high school graduation as a thing, then go on to this next school, then probably get a job.
i just feel it's necessary to draw attention to the fact that there are two problems with access to the school system - not only is it prohibitively expensive but the situation of degree necessity has led to lower standards across the board. it makes more sense to split these kids out of the university system, and let it focus on people that are going to actually end up doing research.
jagmeet singh must cut his beard.
at
03:39
wait, so how do we do this higher education thing right, anyways?
free tuition is the way to go, but we won't have to worry about how to pay for it if we just only let the best students in. all of the bloat comes in when you try and convert a university into a holding ground for underachieving adults. but, the market is really a terrible way to determine criteria to enter a classroom, anyways. first, we need to get the standards up a little, then we need to make access dependent solely on ability to succeed, not on ability to pay.
i guess you can't stop private universities from charging tuition, but, ideally, the public system would be where all of the research funding would be handed out through and all the best students would go - enough that paying to go to school would basically be proof that you're a loser, because you can't get into the free schools. this really ought to be turned on it's head...
when you let the elite institutions be privately run, and the less than elite institutions be publicly run, what the private institutions end up doing is twofold: (1) they take legacy money in terms of grants, in order to tolerate the children of alumni and (2) they use that legacy money to fund scholarships. this is just wasteful, on all kinds of different levels. free from the need to take bribes, the government would be far more efficient at ensuring that the classrooms at the elite institutions are only staffed with the best students. an integrated system could and really should try and combine campuses, as well - it would make sense to have regional physics institutes, for example, rather than a physics department in every city.
but, i'm missing the point about how university is necessary to find employment and so should be covered by public education. except that i'm not. what i'd actually like to see is another 2-4 years of high school, as that is a better way to address that problem than opening up universities to free tuition. there's a lot of things that high school does not address, from basic sciences to statistics to computer programming to business management, that ought to be a part of a basic education, rather than specialized knowledge. that is, after all, what people like senator sanders are really saying, isn't it? that you don't get out of the general pool with (most) two or even a four year degrees nowadays, because you're not learning anything that most people don't learn at some point, anyways.
the universities would need to shift their four year programs, if everybody walks in knowing a year or two of calculus, a year or two of stats, introductory quantum physics, how to program in C and java....but they could just pull graduate level courses down into the four year program and introduce even more abstract courses at the graduate level.
but, it should be free once you get there. if you can get there.
jagmeet singh must cut his beard.
free tuition is the way to go, but we won't have to worry about how to pay for it if we just only let the best students in. all of the bloat comes in when you try and convert a university into a holding ground for underachieving adults. but, the market is really a terrible way to determine criteria to enter a classroom, anyways. first, we need to get the standards up a little, then we need to make access dependent solely on ability to succeed, not on ability to pay.
i guess you can't stop private universities from charging tuition, but, ideally, the public system would be where all of the research funding would be handed out through and all the best students would go - enough that paying to go to school would basically be proof that you're a loser, because you can't get into the free schools. this really ought to be turned on it's head...
when you let the elite institutions be privately run, and the less than elite institutions be publicly run, what the private institutions end up doing is twofold: (1) they take legacy money in terms of grants, in order to tolerate the children of alumni and (2) they use that legacy money to fund scholarships. this is just wasteful, on all kinds of different levels. free from the need to take bribes, the government would be far more efficient at ensuring that the classrooms at the elite institutions are only staffed with the best students. an integrated system could and really should try and combine campuses, as well - it would make sense to have regional physics institutes, for example, rather than a physics department in every city.
but, i'm missing the point about how university is necessary to find employment and so should be covered by public education. except that i'm not. what i'd actually like to see is another 2-4 years of high school, as that is a better way to address that problem than opening up universities to free tuition. there's a lot of things that high school does not address, from basic sciences to statistics to computer programming to business management, that ought to be a part of a basic education, rather than specialized knowledge. that is, after all, what people like senator sanders are really saying, isn't it? that you don't get out of the general pool with (most) two or even a four year degrees nowadays, because you're not learning anything that most people don't learn at some point, anyways.
the universities would need to shift their four year programs, if everybody walks in knowing a year or two of calculus, a year or two of stats, introductory quantum physics, how to program in C and java....but they could just pull graduate level courses down into the four year program and introduce even more abstract courses at the graduate level.
but, it should be free once you get there. if you can get there.
jagmeet singh must cut his beard.
at
02:48
Monday, January 15, 2018
even if we accept the hypothesis that these two muslim girls that falsely claimed hate crimes were doing so because they feared repercussions for being caught without their hijab on, it still leaves open the question of why they would choose this particular approach of escalating to the police.
in the case of the younger one, it could have just been a web of lies that escalated uncontrollably, but, even so, consider the depth of fear required to actually get to a police investigation without cracking. at 11, you have to have some concept of what's happening when the police are involved.
in the case of the older one, though, i'm sure there could have been approaches taken that didn't rely on blaming it on racist white people. like, she could have said it got caught on a tree, or something. why state, specifically, that somebody threatened to light it on fire? you have to know that is going to escalate, if you're a university student, right?
i'm left to think that at least one of these cases may have been a cry for help. and it doesn't seem like anybody's heard it. sadly.
jagmeet singh must cut his beard.
in the case of the younger one, it could have just been a web of lies that escalated uncontrollably, but, even so, consider the depth of fear required to actually get to a police investigation without cracking. at 11, you have to have some concept of what's happening when the police are involved.
in the case of the older one, though, i'm sure there could have been approaches taken that didn't rely on blaming it on racist white people. like, she could have said it got caught on a tree, or something. why state, specifically, that somebody threatened to light it on fire? you have to know that is going to escalate, if you're a university student, right?
i'm left to think that at least one of these cases may have been a cry for help. and it doesn't seem like anybody's heard it. sadly.
jagmeet singh must cut his beard.
at
23:50
well, it would clearly be the latter, wouldn't it, chantal?
it was easier for the opposition to frame the narrative when people got their news from the establishment media that it controlled. the old tory media that i speak of.
nobody under like 50 gets their news this way any more.
so, you can trot your outraged conservative talking heads out on to ctv all you want, nobody really pays any attention any more. worse, that syndicated op-ed piece in the globe and the fp and the ... has a paywall on it. oops. hey, huff post doesn't. but i want to watch something, let me search youtube.
the opposition media of the future might actually have to figure out what people actually care about instead of just feeding it into us, gramscian style. you can't manufacture consent amongst a population that has stopped listening to you. you actually have to adhere to the market.
we call that democracy.
maybe the tory media might want to try a little of it. or it can go bankrupt and be replaced. whatever.
https://www.thestar.com/opinion/star-columnists/2018/01/15/performance-only-part-of-the-story-at-trudeau-town-halls.html
jagmeet singh must cut his beard.
it was easier for the opposition to frame the narrative when people got their news from the establishment media that it controlled. the old tory media that i speak of.
nobody under like 50 gets their news this way any more.
so, you can trot your outraged conservative talking heads out on to ctv all you want, nobody really pays any attention any more. worse, that syndicated op-ed piece in the globe and the fp and the ... has a paywall on it. oops. hey, huff post doesn't. but i want to watch something, let me search youtube.
the opposition media of the future might actually have to figure out what people actually care about instead of just feeding it into us, gramscian style. you can't manufacture consent amongst a population that has stopped listening to you. you actually have to adhere to the market.
we call that democracy.
maybe the tory media might want to try a little of it. or it can go bankrupt and be replaced. whatever.
https://www.thestar.com/opinion/star-columnists/2018/01/15/performance-only-part-of-the-story-at-trudeau-town-halls.html
jagmeet singh must cut his beard.
at
22:45
"They don't understand that I'm fighting their end, because if anybody does that to them, I'll be there." - margaret atwood, describing her younger critics
generational bulges are a problem, because they tend to pit the energy of youth against the wisdom of age. we get over them. and, they can have positive shifts in social attitudes that can, if institutionalized, be maintained. but, that same institutionalization can have dangerous tendencies, as well, when that energy refuses to yield to that wisdom, where it ought to.
so, margaret actually has an important role to play, here. hopefully, she's able to get through to a few people - not necessarily in changing their minds, but in helping them see broader perspectives, and make more careful deductions in doing so.
jagmeet singh must cut his beard
generational bulges are a problem, because they tend to pit the energy of youth against the wisdom of age. we get over them. and, they can have positive shifts in social attitudes that can, if institutionalized, be maintained. but, that same institutionalization can have dangerous tendencies, as well, when that energy refuses to yield to that wisdom, where it ought to.
so, margaret actually has an important role to play, here. hopefully, she's able to get through to a few people - not necessarily in changing their minds, but in helping them see broader perspectives, and make more careful deductions in doing so.
jagmeet singh must cut his beard
at
22:23
see, the backlash to this piece is a good example of americans, and i guess that is beginning to mean young canadians due to the absence of toryism here for some time now, not knowing what a tory is.
the reality is that this is the response that you should have expected from this old tory, margaret atwood.
and, is she right? well, she often is, if you can put what she says through the de-torification process.
she may have picked a poor case to make her point on, however unintentional this may be, but i have to give her moral support, here. she's making the right argument, whether it's applicable in context, or not.
https://www.theglobeandmail.com/opinion/am-i-a-bad-feminist/article37591823/
jagmeet singh must cut his beard
the reality is that this is the response that you should have expected from this old tory, margaret atwood.
and, is she right? well, she often is, if you can put what she says through the de-torification process.
she may have picked a poor case to make her point on, however unintentional this may be, but i have to give her moral support, here. she's making the right argument, whether it's applicable in context, or not.
https://www.theglobeandmail.com/opinion/am-i-a-bad-feminist/article37591823/
jagmeet singh must cut his beard
at
21:50
if you don't mind me putting a damper on this talk of late capitalism.
late capitalism was supposed to mean a period where workers were in the process of taking control of production; if you want to abstract that out of the labour conditions of the nineteenth century, you could suggest that late capitalism is supposed to be a period of democracy, where the people as a whole co-opt production from the elite, and convert it into a tool for use by the masses.
i don't see that happening anywhere.
maybe we're at a point where the technology could allow for a transition, but i don't see it actually happening anywhere in front of me. workers seem to be more afraid that they're going to lose their jobs to automation, than in control of a movement to command it.
what "late capitalism" seems to mean to the people that are throwing it around rather seems to mean a collapse into decadence, as though the founder of historical materialism was nietzsche, or not even, his critics, and the end of capitalism - perhaps with it's underlying work ethic, and the civic values imbued within it by religion - is just a collapse into nihilism. this view conflates the end of capitalism with the end of history, itself perverted from the hegelian term, to mean the end of western history. it's an ultra-paradoxical response to the co-option of marxism into the scare story to preserve religion in the face of secularism. this is what happens when you let anybody that can afford to pay for it go to school.
but, historical materialism was always a pseudo science, anyways. it set down a plausible path of events, and then claimed it was a law of history. if you even want to take the idea seriously enough to do so, you could argue that marx was presenting a classical argument, and that we understand the world today in terms of probabilities rather than certainties. if you want to take it that seriously....
i think the reality is that the united states is not only not in late capitalism, but that it's devolved from a relatively late stage of capitalism under fordism, and moving into the labour movements of the 30s, and into an earlier stage of capitalism, which was accelerated by a return to mercantilism in the 1980s, under the phoney free trade agreements, which were designed to offload labour to countries with lower working conditions.
so, forget about late capitalism. the united states has essentially overseen a global return to mercantilism - which is the decadence that people are identifying. because that is the great comedy of nietzsche, or his critics: that the collapse into nihilism happened in the seventeenth century, and that the classical period of art (and science) is a consequence of it.
jagmeet singh must cut his beard.
late capitalism was supposed to mean a period where workers were in the process of taking control of production; if you want to abstract that out of the labour conditions of the nineteenth century, you could suggest that late capitalism is supposed to be a period of democracy, where the people as a whole co-opt production from the elite, and convert it into a tool for use by the masses.
i don't see that happening anywhere.
maybe we're at a point where the technology could allow for a transition, but i don't see it actually happening anywhere in front of me. workers seem to be more afraid that they're going to lose their jobs to automation, than in control of a movement to command it.
what "late capitalism" seems to mean to the people that are throwing it around rather seems to mean a collapse into decadence, as though the founder of historical materialism was nietzsche, or not even, his critics, and the end of capitalism - perhaps with it's underlying work ethic, and the civic values imbued within it by religion - is just a collapse into nihilism. this view conflates the end of capitalism with the end of history, itself perverted from the hegelian term, to mean the end of western history. it's an ultra-paradoxical response to the co-option of marxism into the scare story to preserve religion in the face of secularism. this is what happens when you let anybody that can afford to pay for it go to school.
but, historical materialism was always a pseudo science, anyways. it set down a plausible path of events, and then claimed it was a law of history. if you even want to take the idea seriously enough to do so, you could argue that marx was presenting a classical argument, and that we understand the world today in terms of probabilities rather than certainties. if you want to take it that seriously....
i think the reality is that the united states is not only not in late capitalism, but that it's devolved from a relatively late stage of capitalism under fordism, and moving into the labour movements of the 30s, and into an earlier stage of capitalism, which was accelerated by a return to mercantilism in the 1980s, under the phoney free trade agreements, which were designed to offload labour to countries with lower working conditions.
so, forget about late capitalism. the united states has essentially overseen a global return to mercantilism - which is the decadence that people are identifying. because that is the great comedy of nietzsche, or his critics: that the collapse into nihilism happened in the seventeenth century, and that the classical period of art (and science) is a consequence of it.
jagmeet singh must cut his beard.
at
21:20
islam is perhaps the last, great mythology for secularism to conquer. we went through hard struggles to defeat christianity, but the battle is largely won. this is my major annoyance with islam - right when we were winning the war against religion, these muslims have provided the cause of religion with a lot of fresh recruits, and in many ways thrown the struggle against religion backwards by a century, or more.
i mean, we have to have legitimate debates, now, over whether it's ok to put your daughters in scarves before they're allowed to leave the house. i don't want this debate. it's anachronistic.
really, it's unfortunate that the contemporary left has aligned with the historical right on this. leftists have generally historically agitated against these kinds of traditional rules, and stood in solidarity with the oppressed - not come up with opaque arguments about cultural relativism, and ignored individual rights in favour of some imaginary idea of collective ones.
so, i stand in solidarity with the girls that take these off. and i call for a future where they don't need to make up absurd excuses to do it, to avoid who knows what - immediate physical punishment, banishment or perhaps even honour killings.
this is the issue, here.
jagmeet singh must cut his beard.
i mean, we have to have legitimate debates, now, over whether it's ok to put your daughters in scarves before they're allowed to leave the house. i don't want this debate. it's anachronistic.
really, it's unfortunate that the contemporary left has aligned with the historical right on this. leftists have generally historically agitated against these kinds of traditional rules, and stood in solidarity with the oppressed - not come up with opaque arguments about cultural relativism, and ignored individual rights in favour of some imaginary idea of collective ones.
so, i stand in solidarity with the girls that take these off. and i call for a future where they don't need to make up absurd excuses to do it, to avoid who knows what - immediate physical punishment, banishment or perhaps even honour killings.
this is the issue, here.
jagmeet singh must cut his beard.
at
19:19
see, it is my immediate deduction from this very limited amount of information that an excuse to take the hijab off is the most obvious explanation:
A University of Michigan student was approached by a stranger who threatened to set her on fire with a lighter if she didn’t remove her hijab, police said.
The incident occurred between 5:30 and 7 p.m. on Friday just outside the campus in Ann Arbor. Police said the woman complied and left.
so, this university student took off the hijab between 5:30 and 7:00 on a friday night and left...perhaps to go to a party, or maybe a bar?
no. that's good. very good. i want to hear more stories like that. but, it perhaps underscores the incredible coercion in muslim families for women to adhere to the dress code, doesn't it?
i think that's the hidden issue, here.
https://www.washingtonpost.com/news/acts-of-faith/wp/2016/11/13/university-of-michigan-student-wearing-a-hijab-threatened-to-be-lit-on-fire-police-say/
jagmeet singh must cut his beard.
A University of Michigan student was approached by a stranger who threatened to set her on fire with a lighter if she didn’t remove her hijab, police said.
The incident occurred between 5:30 and 7 p.m. on Friday just outside the campus in Ann Arbor. Police said the woman complied and left.
so, this university student took off the hijab between 5:30 and 7:00 on a friday night and left...perhaps to go to a party, or maybe a bar?
no. that's good. very good. i want to hear more stories like that. but, it perhaps underscores the incredible coercion in muslim families for women to adhere to the dress code, doesn't it?
i think that's the hidden issue, here.
https://www.washingtonpost.com/news/acts-of-faith/wp/2016/11/13/university-of-michigan-student-wearing-a-hijab-threatened-to-be-lit-on-fire-police-say/
jagmeet singh must cut his beard.
at
19:06
again: is this ultimately an excuse to take the hijab off?
let's hope that this is what's happening. but, i would urge these women to take a larger stand. i can provide some verbal solidarity, but they ultimately must emancipate themselves.
www.cnn.com/2016/12/22/us/michigan-student-hijab-incident-no-evidence/index.html
jagmeet singh must cut his beard.
let's hope that this is what's happening. but, i would urge these women to take a larger stand. i can provide some verbal solidarity, but they ultimately must emancipate themselves.
www.cnn.com/2016/12/22/us/michigan-student-hijab-incident-no-evidence/index.html
jagmeet singh must cut his beard.
at
19:02
nonononono, i would actually consider the idea of a young girl damaging her own hijab to be good news.
that's what i want to see happen: young women getting together and burning these things. not because somebody told them to. but because they don't want to wear them any more.
jagmeet singh must cut his beard.
that's what i want to see happen: young women getting together and burning these things. not because somebody told them to. but because they don't want to wear them any more.
jagmeet singh must cut his beard.
at
18:50
so, what actually happened then?
did she damage her own hijab because she didn't want to wear it, and then claim somebody else did it, so as to not get into any trouble with her parents?
http://www.cbc.ca/beta/news/canada/toronto/scarborough-hijab-attack-1.4487716
jagmeet singh must cut his beard.
did she damage her own hijab because she didn't want to wear it, and then claim somebody else did it, so as to not get into any trouble with her parents?
http://www.cbc.ca/beta/news/canada/toronto/scarborough-hijab-attack-1.4487716
jagmeet singh must cut his beard.
at
18:47
well, his policies are quite similar to harper's, in truth.
but, an interesting overlay would be to chart trudeau's approval rating versus those of donald trump.
https://www.theglobeandmail.com/news/politics/new-poll-shows-deterioration-in-approval-ratings-for-trudeau-liberals/article37601246/
jagmeet singh must cut his beard.
but, an interesting overlay would be to chart trudeau's approval rating versus those of donald trump.
https://www.theglobeandmail.com/news/politics/new-poll-shows-deterioration-in-approval-ratings-for-trudeau-liberals/article37601246/
jagmeet singh must cut his beard.
at
18:40
i think it's a crazy idea. i mean, i don't even want to take it seriously, kind of thing. when somebody comes to you and says "i want an open relationship", what that means is "i want to break up with you, but not for a few more months.". it's the kind of thing that happens when people want to break off a romantic relationship, but not a financial relationship. and, the end result is not actually an open relationship, but the demotion of the relationship to a friendship. partners end up as room mates.
this idea that you can be polyamorous and in a relationship is a consequence of the existing culture, which tells you that you can have your cake and eat it, too. it's a fantasy, in real life. and, i'd suggest to people looking at this seriously that they have to make that choice - that it's ok to be a polyamorous single person, but you shouldn't pretend that you can be in a relationship with somebody, too.
if you're in an open relationship, ask yourself: what does your partner do on saturday nights?
that's how you figure it out, right. if you find yourself in a situation where you're spending more saturdays apart than together, you don't actually have a relationship any more. what you have is a room mate.
and, in the real world, things get messy. three or four people might show up at the same concert, or the same restaurant. and, if you're avoiding that, what are you doing? making plans to not spend time with your partner? if you have to avoid your partner on a saturday night, there's no relationship there...
it's fun to be open-minded. but, when you start thinking through the ramifications, it doesn't work. and, it is an empirical question: the arrangement doesn't tend to work.
the prudent advice to give somebody going through this is to try and predict the outcome of such an arrangement in a few months time. and, it's not usually going to be a positive outcome, unless you either have both partners pursuing other options (in which case it's a mutual break-up in disguise), or you have one partner that likes to spend a lot of time alone, and isn't going to spend it thinking about where the other one is, or what they're doing.
in most cases, the person being propositioned with such a thing should take it as a red flag and walk away.
at
17:45
i don't have an issue with the language used. the distribution is the curve, or everything under the curve. it's a semantic point that a statistician would be splitting hairs over in "correcting" you on and most actually probably wouldn't bother with at all. a major hurricane hitting the united states would be a rare event, and whether you want to describe that using a "poisson distribution" or the "curve described by the poisson distribution" is just an issue in language, although i would perhaps suggest that you're misapplying the central limit theorem in a situation with not enough data points to do so, if that's what you're getting at by referencing normality. a misapplication of the clt like this could actually be used to argue for stasis. it doesn't change the point you're making.
and, yes - charting an increase in hurricanes since 2005 is kind of like charting a decrease in temperatures since 1998. or jet stream variability since 1725.
but, the important thing you pointed out was that global warming is not the only factor. and, if you want to push this on this platform, that's the most important point you can make: the universe is complicated, and this increase in carbon on this planet is just one of the things that's happening in it.
at
17:20
so, i just accomplished something - i've closed all of the audio for period 2.
so, this is where i put the placeholder for period 2, for now.
https://jasonparent.bandcamp.com/album/period-2
that means my discography is now completed for the period 1996-2003, with the caveat that i'll need to add a pdf file to each release for liner notes, and i have to finish the period 1 & period 2 discs, which are html front-ends on a pdf file that is the culmination of all of the individual ones.
i still have some work to do on this.
but, what's next?
it's jan, 1998 in the alter-reality. i left off in dec, 1996.that's a year worth a journal writing, and i'll need to get to it soon. but, i need to recalibrate, first.
first, i need to clean in here. i need to ship the rest of that order. but, i feel better about it now, because i'm over that hump.
i'm not sure how long it's going to take to recalibrate and get all this data in line, but i should be coming up on absolute final closes on inri000-inri015 in the upcoming weeks. and, then i need to stay up to date...
jagmeet singh must cut his beard.
so, this is where i put the placeholder for period 2, for now.
https://jasonparent.bandcamp.com/album/period-2
that means my discography is now completed for the period 1996-2003, with the caveat that i'll need to add a pdf file to each release for liner notes, and i have to finish the period 1 & period 2 discs, which are html front-ends on a pdf file that is the culmination of all of the individual ones.
i still have some work to do on this.
but, what's next?
it's jan, 1998 in the alter-reality. i left off in dec, 1996.that's a year worth a journal writing, and i'll need to get to it soon. but, i need to recalibrate, first.
first, i need to clean in here. i need to ship the rest of that order. but, i feel better about it now, because i'm over that hump.
i'm not sure how long it's going to take to recalibrate and get all this data in line, but i should be coming up on absolute final closes on inri000-inri015 in the upcoming weeks. and, then i need to stay up to date...
jagmeet singh must cut his beard.
at
03:16
republishing inri074
around
october, 2002 i met a friend. i was sort of in need of a friend, and i
mean that in the friend sense. but, the mental condition i was in was
the explanation of why i needed a friend, if you see what i mean; i was
completely unstable in this period and did all kinds of absurd things,
which isolated me - and i wasn't getting any better.
i dropped out of school under the realization that i was walking down a path that wasn't getting me anywhere close to what i wanted out of life. i ended up working three jobs to raise money for gender reassignment, and it crossed me paths with somebody that was also trying to think of ways to get out of the box in terms of ways to exist.
she was trying to save up money to go to british columbia. it was some kind of warped take on the grapes of wrath, where everything works out perfectly. but, the rent was eating into her savings, which was making the goal seem impossible. well, unless we stopped having fun.
so, i suggested she should just stay at my parents place. part of it was a hope that she would move her drum kit in, although that didn't happen. and, i might add that this was done with all of the reckless abandon that could be contemplated - we were moving stuff in without even asking, it was really remarkable.
and, it seemed to me that we were getting pretty close over that period.
so, when the time came that she had all that money put aside to go to bc, it was kind of a downer to let her go. and, she initially wanted to go with a friend who dropped out. so, i ended up going across the country with her.
now, i need to be clear: we weren't planning on coming back. we were going to pick fruit or something - we didn't know, exactly, we'd figure it out when we got there.
so, this was meant as a sort of farewell to certain people i hadn't talked to in months and didn't care if i was leaving, anyways. i think it let me work some things out on weird subconscious levels, but the truth is that these songs really aren't about anybody except me, and there's no use in pretending they are - i just liked the idea of a farewell disc.
this disc was initially passed around with a cut up version of the pretentious untitled mix at the end, but this was almost immediately ejected from future burns and is not present on this ep due to the poor quality of the mix. the remaining five tracks became combined into what i now call my eighth symphony.
written and recorded in late 2002 and early 2003. this was initially uploaded unmodified from a cd-r rip in may, 2015, but this was replaced with a version from source on nov 29, 2017 due to clipping due to an unrealized normalization on the burn. disc finalized as symph008 on nov 29, 2017. as always, please use headphones.
the hidden track is the final version and also appears on my ninth record, {e} (inri08x): jasonparent.bandcamp.com/album/e
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2003, 2015, 2017).
i dropped out of school under the realization that i was walking down a path that wasn't getting me anywhere close to what i wanted out of life. i ended up working three jobs to raise money for gender reassignment, and it crossed me paths with somebody that was also trying to think of ways to get out of the box in terms of ways to exist.
she was trying to save up money to go to british columbia. it was some kind of warped take on the grapes of wrath, where everything works out perfectly. but, the rent was eating into her savings, which was making the goal seem impossible. well, unless we stopped having fun.
so, i suggested she should just stay at my parents place. part of it was a hope that she would move her drum kit in, although that didn't happen. and, i might add that this was done with all of the reckless abandon that could be contemplated - we were moving stuff in without even asking, it was really remarkable.
and, it seemed to me that we were getting pretty close over that period.
so, when the time came that she had all that money put aside to go to bc, it was kind of a downer to let her go. and, she initially wanted to go with a friend who dropped out. so, i ended up going across the country with her.
now, i need to be clear: we weren't planning on coming back. we were going to pick fruit or something - we didn't know, exactly, we'd figure it out when we got there.
so, this was meant as a sort of farewell to certain people i hadn't talked to in months and didn't care if i was leaving, anyways. i think it let me work some things out on weird subconscious levels, but the truth is that these songs really aren't about anybody except me, and there's no use in pretending they are - i just liked the idea of a farewell disc.
this disc was initially passed around with a cut up version of the pretentious untitled mix at the end, but this was almost immediately ejected from future burns and is not present on this ep due to the poor quality of the mix. the remaining five tracks became combined into what i now call my eighth symphony.
written and recorded in late 2002 and early 2003. this was initially uploaded unmodified from a cd-r rip in may, 2015, but this was replaced with a version from source on nov 29, 2017 due to clipping due to an unrealized normalization on the burn. disc finalized as symph008 on nov 29, 2017. as always, please use headphones.
the hidden track is the final version and also appears on my ninth record, {e} (inri08x): jasonparent.bandcamp.com/album/e
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2003, 2015, 2017).
credits
released May 3, 2003
j - guitar, effects, bass, synth, voice, piano, drum programming, generative programming (sounder), granular synthesis, sound design, soundscaping, loops, bowls, claps, tables, ebow, orchestral sequencing, digital wave editing, sampling, production, composition
jagmeet singh must cut his beard.
j - guitar, effects, bass, synth, voice, piano, drum programming, generative programming (sounder), granular synthesis, sound design, soundscaping, loops, bowls, claps, tables, ebow, orchestral sequencing, digital wave editing, sampling, production, composition
jagmeet singh must cut his beard.
at
02:41
Sunday, January 14, 2018
publishing inri073
it was in
may of 2015 that i first contemplated the idea of a chamber works. i was
creating compilations to end my second period, when i realized that a
couple of the tracks that did not fit well into the orchestral works
might work better as chamber pieces. so, the chamber works was intended
as a kind of companion disc to the orchestral works, both to offer a
different flavour and to collect the remaining tracks into a compilation
of serious music, so they are not left out.
so, i went back and did a systematic evaluation of the period 2 material to see which tracks could or could not be converted into chamber pieces. the last three mixes were created at this time, while the first was removed of clicks.
then, i stopped. i decided that an electronic chamber works was an idea of questionable worth, and i should put the idea aside for a bit and take a look at the idea again upon reconstruction of the period 1 tapes.
what the issue really comes down to is how good the electronic strings sound. does this actually sound like chamber music, or does it sound like a computer creating chamber music? and, if it sounds like a computer, is the issue resolvable somehow?
when i came back to completing period 2 in the fall of 2017, i decided in favour of the release, as the sound fonts are convincing enough, even if one needs to ignore a few relics here and there. tracks two and three were subsequently added to the compilation.
i decided at the end that this format has some future to it, whether it is fully realistic or not. string music will probably never go away. but, composers are going to find themselves less and less interested in actual physical reproduction, as time moves forward. the question of realism in the tracks is consequently somewhat misplaced, as the chamber music of the future is likely to be performed by computers, and sound like it just a little bit.
initially written and recorded between 2001-2003 and remixed and recorded further over 2014-2015. an idea for this compilation was developed over the last week of may, 2015, but it was not finished or released at that time. corrected and expanded from october, 2017 to january, 2018. finally released & finalized as lp022 on jan 14, 2018. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017, 2018).
so, i went back and did a systematic evaluation of the period 2 material to see which tracks could or could not be converted into chamber pieces. the last three mixes were created at this time, while the first was removed of clicks.
then, i stopped. i decided that an electronic chamber works was an idea of questionable worth, and i should put the idea aside for a bit and take a look at the idea again upon reconstruction of the period 1 tapes.
what the issue really comes down to is how good the electronic strings sound. does this actually sound like chamber music, or does it sound like a computer creating chamber music? and, if it sounds like a computer, is the issue resolvable somehow?
when i came back to completing period 2 in the fall of 2017, i decided in favour of the release, as the sound fonts are convincing enough, even if one needs to ignore a few relics here and there. tracks two and three were subsequently added to the compilation.
i decided at the end that this format has some future to it, whether it is fully realistic or not. string music will probably never go away. but, composers are going to find themselves less and less interested in actual physical reproduction, as time moves forward. the question of realism in the tracks is consequently somewhat misplaced, as the chamber music of the future is likely to be performed by computers, and sound like it just a little bit.
initially written and recorded between 2001-2003 and remixed and recorded further over 2014-2015. an idea for this compilation was developed over the last week of may, 2015, but it was not finished or released at that time. corrected and expanded from october, 2017 to january, 2018. finally released & finalized as lp022 on jan 14, 2018. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017, 2018).
credits
released May 2, 2003
j - controller input, programming, effects processing, mixing, digital wave editing, composition.
the various rendered electronic orchestras include piano, orchestral drum kit, violin, guitar, viola, cello, contrabass, various string sections and choir.
j - controller input, programming, effects processing, mixing, digital wave editing, composition.
the various rendered electronic orchestras include piano, orchestral drum kit, violin, guitar, viola, cello, contrabass, various string sections and choir.
jagmeet singh must cut his beard.
at
19:22
publishing inri072
an
unexpected result of the project to complete my discography, undertaken
in late 2013, has been the construction of a handful of orchestral
pieces, mostly as remixes of original tracks from the
jjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjjj period. while these
tracks were initially written out as scored pieces for expanded
instrumentation, they were generally written around the guitar and the
expanded instrumentation was largely meant simply for colour. the
exception to this is the psilocybin symphony, which was written as a
piano concerto from the start and previously completed in early 2006.
the ability to expand these pieces into orchestral works is the result of the advances in vst sampling technology that have occurred since 2003. while changes in instrumentation have been accompanied by extra writing (mostly on the guitar), tempo shifts and other general rearrangement choices, the existing technology makes it very easy to rearrange a rock song for an orchestra, by simply multiplying staves and changing the sound fonts.
the condition i've set for a piece to be "orchestral" is that it must utilize the entire orchestra: it must have percussion, piano, horns, woodwinds/reeds and strings. guitars are generally treated like "first violins", whereas violins are generally not considered to be more special than other similar string instruments. some of the tracks also have prominent choral sections. all of these pieces meet this condition, except the last one which does not have a woodwind/reed section.
my delve into scorewriting ended in 2003; the material in my third phase is more focused on live and manipulated guitars and synthesizers. i consequently feel that this is an interesting summary of my second period, taken from a specific angle that is otherwise largely relegated to single-only remixes.
initially written and recorded between 2001-2003 and remixed and recorded further over 2014-2015, except track 2 which was completed in early 2006 and track 5 which was completed in 2017. the initial final compilation date was may 23, 2015, but track five was then added on oct 14, 2017 and the disc was finalized as lp021 on nov 29, 2017. track 7 was added as a download-only bonus track on jan 14, 2018. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017, 2018).
* download only
the ability to expand these pieces into orchestral works is the result of the advances in vst sampling technology that have occurred since 2003. while changes in instrumentation have been accompanied by extra writing (mostly on the guitar), tempo shifts and other general rearrangement choices, the existing technology makes it very easy to rearrange a rock song for an orchestra, by simply multiplying staves and changing the sound fonts.
the condition i've set for a piece to be "orchestral" is that it must utilize the entire orchestra: it must have percussion, piano, horns, woodwinds/reeds and strings. guitars are generally treated like "first violins", whereas violins are generally not considered to be more special than other similar string instruments. some of the tracks also have prominent choral sections. all of these pieces meet this condition, except the last one which does not have a woodwind/reed section.
my delve into scorewriting ended in 2003; the material in my third phase is more focused on live and manipulated guitars and synthesizers. i consequently feel that this is an interesting summary of my second period, taken from a specific angle that is otherwise largely relegated to single-only remixes.
initially written and recorded between 2001-2003 and remixed and recorded further over 2014-2015, except track 2 which was completed in early 2006 and track 5 which was completed in 2017. the initial final compilation date was may 23, 2015, but track five was then added on oct 14, 2017 and the disc was finalized as lp021 on nov 29, 2017. track 7 was added as a download-only bonus track on jan 14, 2018. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017, 2018).
* download only
credits
released May 1, 2003
j - controller inputs, drum & other programming, orchestral & other sequencing, live guitars, live bass, live synths, effects, sound design, digital wave editing, composition, production.
the various rendered electronic orchestras includes violin, viola, cello, contrabass, electric guitar, nylon guitar, guitar fret noise, bass guitar, synthesizer bass, french horn, trumpet, trombone, tuba, english horn, oboe, bassoon, clarinet, saxophone, bamboo flute, flute, piccolo, synthesizers, mellotron, organ, piano, harp, koto, music box, clavinet, kalimba, xylophone, agogo, mallet, hammered percussion, woodblock, tubular bells, tinkle bells, glockenspiel, orchestra hit, melodic toms, electronic drum kit, timpani, orchestral drum kit and choir.
j - controller inputs, drum & other programming, orchestral & other sequencing, live guitars, live bass, live synths, effects, sound design, digital wave editing, composition, production.
the various rendered electronic orchestras includes violin, viola, cello, contrabass, electric guitar, nylon guitar, guitar fret noise, bass guitar, synthesizer bass, french horn, trumpet, trombone, tuba, english horn, oboe, bassoon, clarinet, saxophone, bamboo flute, flute, piccolo, synthesizers, mellotron, organ, piano, harp, koto, music box, clavinet, kalimba, xylophone, agogo, mallet, hammered percussion, woodblock, tubular bells, tinkle bells, glockenspiel, orchestra hit, melodic toms, electronic drum kit, timpani, orchestral drum kit and choir.
jagmeet singh must cut his beard.
at
04:10
republishing inri071
i've taken
to splitting my discography into phases, and my hitch-hiking trip to
british columbia is a very important separation point - both in terms of
the nature of the material that came out afterwards and what is now a
substantial body of work that came before it. that makes it a natural
point to look backwards and build compilations of intersecting ideas.
a characteristic of my work is that it does not conform well to genre norms. this is not an accident; when compiling a record, i'm guided more by the late beatles' philosophy of vast diversity in a small space than i am by any kind of desire to collect together nice singles, or by some kind of compulsive organizing into categories or concepts. i write psychedelic music. that means something different in 2015 than it did in 1966, but the commonality is that it's necessarily challenging. i want all of my records to do everything at once, and accomplish everything by their end point. that makes compilations of this sort inherently difficult, because every song touches on every compilation idea at the same time. the jazz record would have the same tracklisting as the punk record, the classical record and the folk record - and none would really be what they're claimed to be.
the one exception to this conundrum is how i interacted with ambient music in this period. i very regularly utilized ideas from the genre, but i tended to interpret ambience as something that is necessarily obscure. in this period, ambient pieces are almost always outtakes or b sides. i tended to interpret covers and remixes as ambient pieces, probably because that was unexpected. when ambient ideas make it on to the record, they're almost always for effect: introductions, endings, connecting passages, that sort of thing.
when i began reconstructing my discography in early 2014, i came across a handful of songs i'd written out into midi format and put aside for later. a number of these ended up reworked into ambient pieces, and released as b sides. i also ended up converting some of the material i wrote in this period into ambient sound collages that are more in the style of music i created after 2003.
the end result is enough bsides and remixes to put together two full cds of ambient music. none of the tracks on volumes one or two are on any official record as they appear here; this is technically a collection of remixes and outtakes.
this package was initially released with a mix tape of fragments from 1996-1999, but it has since been moved into it's own release (inri035): jasonparent.bandcamp.com/album/ambient-works-vol-0
initially written and recorded between 2000-2003 and remixed between 2014-2015. sequenced over mid may, 2015. the final compilation date was initially may 20, 2015, but both discs were mildly updated with some more appropriate mixes of the same tracks on nov 29, 2017; disc subsequently finalized as lp020. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017).
a characteristic of my work is that it does not conform well to genre norms. this is not an accident; when compiling a record, i'm guided more by the late beatles' philosophy of vast diversity in a small space than i am by any kind of desire to collect together nice singles, or by some kind of compulsive organizing into categories or concepts. i write psychedelic music. that means something different in 2015 than it did in 1966, but the commonality is that it's necessarily challenging. i want all of my records to do everything at once, and accomplish everything by their end point. that makes compilations of this sort inherently difficult, because every song touches on every compilation idea at the same time. the jazz record would have the same tracklisting as the punk record, the classical record and the folk record - and none would really be what they're claimed to be.
the one exception to this conundrum is how i interacted with ambient music in this period. i very regularly utilized ideas from the genre, but i tended to interpret ambience as something that is necessarily obscure. in this period, ambient pieces are almost always outtakes or b sides. i tended to interpret covers and remixes as ambient pieces, probably because that was unexpected. when ambient ideas make it on to the record, they're almost always for effect: introductions, endings, connecting passages, that sort of thing.
when i began reconstructing my discography in early 2014, i came across a handful of songs i'd written out into midi format and put aside for later. a number of these ended up reworked into ambient pieces, and released as b sides. i also ended up converting some of the material i wrote in this period into ambient sound collages that are more in the style of music i created after 2003.
the end result is enough bsides and remixes to put together two full cds of ambient music. none of the tracks on volumes one or two are on any official record as they appear here; this is technically a collection of remixes and outtakes.
this package was initially released with a mix tape of fragments from 1996-1999, but it has since been moved into it's own release (inri035): jasonparent.bandcamp.com/album/ambient-works-vol-0
initially written and recorded between 2000-2003 and remixed between 2014-2015. sequenced over mid may, 2015. the final compilation date was initially may 20, 2015, but both discs were mildly updated with some more appropriate mixes of the same tracks on nov 29, 2017; disc subsequently finalized as lp020. as always, please use headphones.
this release also includes a printable jewel case insert and will also eventually include a comprehensive package of journal entries from all phases of production (2014, 2015, 2017).
credits
released April 28, 2003
j - guitars (acoustic, electric, nylon), effects & treatments, bass, synthesizers, electric air reed organ, orchestral & other sequencing, drum & other programming, generative programming (sounder), "projectile synthesis" (audiomulch), granular synthesis (granulab), sound design, electronic and conventional drum kits, sampling, loops, films, voice, digital wave editing, composition, production.
sean - vocal ideas (tracks 4 & 7, disc 1), ring modulator (track 9, disc 1)
jon - background guitar performance (track 4, disc 1)
greg - drum performance sample source (track 5, disc 1)
the various rendered electronic orchestras include synth bass, electric bass, acoustic bass, electric guitar, acoustic guitar, nylon guitar, guitar effects, guitar noises (fret noises, pick scrapes, knocks), synthesizer, synth pads, mellotron, choir, violin, viola, cello, contrabass, string section, pizzicato strings, french horn, trumpet, trombone, tuba, oboe, english horn, bassoon, clarinet, flute, piccolo, mallet, piano, woodblock, music box, xylophone, tubular bells, other bells, orchestra hit, electronic drum kit, melodic toms, drum machine and orchestral drum kit.
j - guitars (acoustic, electric, nylon), effects & treatments, bass, synthesizers, electric air reed organ, orchestral & other sequencing, drum & other programming, generative programming (sounder), "projectile synthesis" (audiomulch), granular synthesis (granulab), sound design, electronic and conventional drum kits, sampling, loops, films, voice, digital wave editing, composition, production.
sean - vocal ideas (tracks 4 & 7, disc 1), ring modulator (track 9, disc 1)
jon - background guitar performance (track 4, disc 1)
greg - drum performance sample source (track 5, disc 1)
the various rendered electronic orchestras include synth bass, electric bass, acoustic bass, electric guitar, acoustic guitar, nylon guitar, guitar effects, guitar noises (fret noises, pick scrapes, knocks), synthesizer, synth pads, mellotron, choir, violin, viola, cello, contrabass, string section, pizzicato strings, french horn, trumpet, trombone, tuba, oboe, english horn, bassoon, clarinet, flute, piccolo, mallet, piano, woodblock, music box, xylophone, tubular bells, other bells, orchestra hit, electronic drum kit, melodic toms, drum machine and orchestral drum kit.
jagmeet singh must cut his beard.
at
00:05
Saturday, January 13, 2018
“Every missile or shell we fired was at a valuable target, at
underground targets,” Eisenkot said in March “We have developed a
capability that allows us to strike them.”
you know that's what this is really about, right?
gaza isn't just an open-air prison. it's a model of a city in revolt. such technology can ultimately be exported to countries like the united states, in the event of the outbreak of armed civil unrest.
the talk of colonialism is weird. it's maybe true from a certain perspective, but it's an effect rather than a cause, and the historical underpinnings of it are somewhat spurious. at best, these are two opposing colonial cultures. but, it really has nothing to do with the actual reality of why israel exists.
israel is an american military outpost in the middle east, necessary as a counter-balance against a tense alliance with the oil-producing arab countries. it's primary function is as a testing facility.
so, finkelstein claims there weren't any rockets being sent from gaza. maybe he means a statistical zero, because the system was ultimately designed to test the rockets that were sent at it for it to shoot down. so, of course it shot down some rockets. it's a test simulation to shoot them down.
comparisons to the holocaust are not exaggerated, and that's why i tend to avoid the term apartheid. apartheid is an economic idea - it's a slave class that existed, for the benefit of the rich members of society. and, so, what they did in south africa was allow a select group of blacks to enter the ruling class, while keeping the apartheid system mostly in place. that cannot happen in palestine, where the people are not being utilized as a slave class, but merely tossed aside as useless eaters.
the united states actually presented an apartheid system as a solution to the actual genocide that's taking place, which is how i prefer to describe it. john kerry wanted to build call centres in the west bank, and convert the palestinians into a pool of cheap labour for multinational corporations. that would have resulted in an apartheid, where palestinians are kept occupied with labour for the dominant israeli group, while being denied basic liberties and civil rights. but, israel wouldn't allow for this. they just want the land they're standing on.
so, referring to the situation as an apartheid actually deflects from the deeper reality, that israel is carrying out a genocide in slow motion, with the ultimate aim of complete expulsion - or annihilation.
but, to america, it's just a war game. and, americans ought to understand that, for what it is.
notwithstanding pull from outside forces, this geo-strategic position is necessary for as long as america relies upon oil as a dominant input into it's economy.
jagmeet singh must cut his beard.
you know that's what this is really about, right?
gaza isn't just an open-air prison. it's a model of a city in revolt. such technology can ultimately be exported to countries like the united states, in the event of the outbreak of armed civil unrest.
the talk of colonialism is weird. it's maybe true from a certain perspective, but it's an effect rather than a cause, and the historical underpinnings of it are somewhat spurious. at best, these are two opposing colonial cultures. but, it really has nothing to do with the actual reality of why israel exists.
israel is an american military outpost in the middle east, necessary as a counter-balance against a tense alliance with the oil-producing arab countries. it's primary function is as a testing facility.
so, finkelstein claims there weren't any rockets being sent from gaza. maybe he means a statistical zero, because the system was ultimately designed to test the rockets that were sent at it for it to shoot down. so, of course it shot down some rockets. it's a test simulation to shoot them down.
comparisons to the holocaust are not exaggerated, and that's why i tend to avoid the term apartheid. apartheid is an economic idea - it's a slave class that existed, for the benefit of the rich members of society. and, so, what they did in south africa was allow a select group of blacks to enter the ruling class, while keeping the apartheid system mostly in place. that cannot happen in palestine, where the people are not being utilized as a slave class, but merely tossed aside as useless eaters.
the united states actually presented an apartheid system as a solution to the actual genocide that's taking place, which is how i prefer to describe it. john kerry wanted to build call centres in the west bank, and convert the palestinians into a pool of cheap labour for multinational corporations. that would have resulted in an apartheid, where palestinians are kept occupied with labour for the dominant israeli group, while being denied basic liberties and civil rights. but, israel wouldn't allow for this. they just want the land they're standing on.
so, referring to the situation as an apartheid actually deflects from the deeper reality, that israel is carrying out a genocide in slow motion, with the ultimate aim of complete expulsion - or annihilation.
but, to america, it's just a war game. and, americans ought to understand that, for what it is.
notwithstanding pull from outside forces, this geo-strategic position is necessary for as long as america relies upon oil as a dominant input into it's economy.
jagmeet singh must cut his beard.
at
19:55
this article also explains why he has long odds to win in 2019, at all. and, then what?
the ndp have found themselves in a position that i last remember seeing in canadian politics with the old progressive conservatives, when joe clark had to ask somebody to step aside to give them his seat. the party only managed to recover to the point that they could organize a merger with the reform party. whatever happens to the ndp, the canadian left needs some kind of serious renewal, likely in a new party.
what can they do in this mess?
well, there's two choices, really, within our parliamentarian tradition, and they rely on the strength of the leadership. grenier doesn't think that singh will ask masse or hardcastle to step down. what that means is that grenier doesn't think that singh is powerful enough in his own party to take a seat away from an incumbent. yet, that is, in fact, the parliamentarian tradition in this circumstance, where the leadership is powerful enough - and clark is one example of that happening. if grenier is right, and singh is not able to command a seat from a backbencher, then the party must pass a vote of non-confidence, and have singh removed as leader.
what's happening right now, where there are two entities moving in different directions, is not within the parliamentary tradition of canada. there's no way to describe this than watching the party implode and collapse.
somebody needs to take charge. either singh has control of the party and can get a seat from a backbencher, or he does not have the confidence of the party, and should be removed from the leadership.
http://www.cbc.ca/news/politics/grenier-singh-seats-1.4477621
jagmeet singh must cut his beard.
the ndp have found themselves in a position that i last remember seeing in canadian politics with the old progressive conservatives, when joe clark had to ask somebody to step aside to give them his seat. the party only managed to recover to the point that they could organize a merger with the reform party. whatever happens to the ndp, the canadian left needs some kind of serious renewal, likely in a new party.
what can they do in this mess?
well, there's two choices, really, within our parliamentarian tradition, and they rely on the strength of the leadership. grenier doesn't think that singh will ask masse or hardcastle to step down. what that means is that grenier doesn't think that singh is powerful enough in his own party to take a seat away from an incumbent. yet, that is, in fact, the parliamentarian tradition in this circumstance, where the leadership is powerful enough - and clark is one example of that happening. if grenier is right, and singh is not able to command a seat from a backbencher, then the party must pass a vote of non-confidence, and have singh removed as leader.
what's happening right now, where there are two entities moving in different directions, is not within the parliamentary tradition of canada. there's no way to describe this than watching the party implode and collapse.
somebody needs to take charge. either singh has control of the party and can get a seat from a backbencher, or he does not have the confidence of the party, and should be removed from the leadership.
http://www.cbc.ca/news/politics/grenier-singh-seats-1.4477621
jagmeet singh must cut his beard.
at
17:48
Subscribe to:
Posts (Atom)