this idea in the anti-gmo movement that you can absorb modified dna somehow is science fiction. organisms can steal dna from other organisms, but it is something that becomes less and less feasible as life becomes more and more complex.

what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.

maybe some diagrams might help.

suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata

your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata

your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.

there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.

jagmeet sing must cut his beard.