Osmund Cooke

Not sure if I was listening carefully, but can an enzyme split an atom and create nuclear fission?

Something like oxidoreductase or acid base catalysis

deathtokoalas

i believe you can find evidence for your hypothesis in the phenomenon of explosive diarrhoea.

this idea in the anti-gmo movement that you can absorb modified dna somehow is science fiction. organisms can steal dna from other organisms, but it is something that becomes less and less feasible as life becomes more and more complex.

what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.

maybe some diagrams might help.

suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata

your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata

your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.

there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.

jagmeet sing must cut his beard.

an opportunity, perhaps, but, as justin is not his father, this is not the ndp of the 60s or the 70s, either. i frankly don't think they have the credibility on the left to put up a believable opposition to free trade. this is where the ghost of mulcair appears and haunts the ndp forever, as he was very tepid in his criticism of the tpp, and projected fairly clearly that he intended to support it if he had won in 2015. if i am correct that jagmeet singh is a creature of the ndp leadership, it's not even clear what the actual policy position even is, let alone if they can lead an opposition movement that is, issue-by-issue, well to the left of where the party currently sits.

in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.

i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...

https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html

jagmeet singh must cut his beard.

but, what would you do if you were free?

i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.

see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.

immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.

unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.

because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.

so, what would you do if you were free?

then, do it.

jagmeet singh must cut his beard.