Monday, January 29, 2018

so, how important were the iranians - the alans - in building what we call france, anyways?

well, we know there were substantial migrations of iranians into france, as there were substantial migrations of celts back into the plateaus. there was a two-way flow there, for a long time.

we also know that there was enough of a settled iranian presence in the areas around belgium and northern france, the origin area of the franks, that shrines were built to iranian deities, although there is a curious tendency in the literature to attribute this to trade contacts and a mass fetish for 'orientalism', despite the known migration histories. i put these two facts together and deduce that there were established iranian settlements in this region, just before the franks appear kind of out of nowhere.

the franks weren't really an ethnic confederacy. it was a german word, but it meant the free tribes of varying sorts in that particular region at the corner of the empire: celts, germans and enough iranians to take note of. but, the iranians tend to be ignored due to the fact that they did, indeed, assimilate to the new germanicized roman order, whereas the celts kind of held out.

there's a specific area of the map in france where everything is all about alan. everything ends up named alain in some abstraction, from mountains to cities to rivers to people. alain is probably recognizable to most as a french name, but it is actually iranian in origin, and a memory of the iranian tribe of alans that settled that area, before they vanished to history.

the idea i want to put forward is that they were probably important enough in the development of the frankish federation that they contributed to the cimmerian origin myth, which said that the franks came from the area around scythia, after a fancy detour through both trojan and roman lore. but, these were invented histories, invented purposefully to control the population with. the alans at least came from scythia, though. they appear to have been important enough to be necessary to include in the composite. and, due to the composite, we can indeed remember their importance in the federation.

jagmeet singh must cut his beard.
our mining companies are out of control.

so, this is much called for, as a preliminary step. i've argued in the past that we should be using the rome convention to prosecute human rights abuses...and there are stories of villages being burned down, mass rape, just horrific behaviour....

as this is tied into the country's image, and the prime minister is greatly concerned about this, it's difficult to tell if this is serious or not. you'd assume it isn't, a priori, but it's actually in a priority zone for the pmo. at least the government is recognizing that there is a serious problem with how canadian mining businesses, especially, are conducting themselves overseas.

http://www.cbc.ca/news/politics/corporate-ombudsman-abroad-1.4491388

jagmeet singh must cut his beard.
i'm sorry, i just think that the proper political entity to fight brexit is the liberal party, and not the labour party. and, i actually want to see them do it; this would be the correct unfolding of a process in history.

really, the british liberals are missing in action, right now. and, it's an affront to history. it's not too late.

jagmeet singh must cut his beard.
that commercial for the liberals in the uk should be created as a dramatic personal reflection. just somebody talking to themselves...

"i'm a liberal.

(rising orchestral music slowly fades in).

wait. i just got it. i'm....i'm a liberal.

a liberal.

(rising music coming to climax)

I'M A LIBERAL.

(crashes of whatever type, maybe backwards guitars and distorted cellos, with a deep gong and some electronic noise filling out the spectrum.)

so, i should vote Liberal.

(music fades...)

'cause i'm a liberal.

(music stops)

get it?"

jagmeet singh must cut his beard.

Sunday, January 28, 2018

it's not a question of if the chinese have operatives in canada, but a question of how many chinese operatives exist in canada.

the chinese appear to be rather unhappy with us, at the moment.

this is just such absolutely convoluted thinking that it's almost impossible to believe that hundreds of people around the country all think that the prime minister has anything to do with the girl's description of her attacker.

and, if i understand correctly, they seem to want the prime minister to walk back a statement of solidarity with a child that claimed she was randomly attacked. what planet does the chinese intelligence live on where this is a remotely acceptable thing to even think?

maybe i'm missing some cultural chinese thing, or something. but most canaduans aren't even going to understand what these people are protesting, and you can't agree or disagree with something if you can't even make sense of it.

i have no idea why the news covered this.

http://www.cbc.ca/news/canada/saskatchewan/protest-regina-victoria-park-asian-community-hijab-cutting-1.4508019

jagmeet singh must cut his beard.
"they're not real christians".

au contraire. these are the realest christians in the hood.

well, elizabeth, they may forgive you for the times that you expressed yourself clearly, but they might not forgive you for the times when you expressed yourself through jumbled, slurred words.

sour grapes, indeed.

http://www.cbc.ca/news/politics/elizabeth-may-green-party-1.4507332

jagmeet singh must cut his beard.
i think trudeau phrased that a little bit frighteningly.

"Sexual harassment is a systemic problem. It is unacceptable. When women speak up, it is our duty to listen to them"

great. perfect statement. every decent person in the world agrees with you. that's what a snazzy politician produces.

"...and to believe them."

gah. you just lost the room, man. i know your strategists are telling you one thing about the political usefulness of projecting feminism, if you want to claim this is feminism, but you've really got the...you've got the entire political spectrum, save the hardest part of the pseudo-left, against you. and, worse, this pseudo-left is really feeding off of the corporate media, which is using the thing, however genuine, as a screen to get rid of people - i don't think it's a witch hunt, so much as i think there's a list, somewhere, and somebody's scratching names off of it. it's a purge. then, there's the opportunists, too.

i don't even completely disagree with him. i mean, sure, you should believe these women....if they're convincing. it's the implication of blanket belief that is rightfully drawing criticism from every direction on the spectrum. not because it's anti-feminist, but because it's inherently irrational.

i'm sure he'd clarify, if presented with an opportunity, that he was speaking in generalities, and not including the exceptions. but he said it in a way that...

either he's not being scripted closely enough, or he's not following it. he shouldn't have said that like that. that's going to freak people out.

it shouldn't, but it will.

but, flip past that and look at the response from the ministers - it's pretty much exactly what you'd want to hear a government say. they were clear to point out the need for due process.

the liberals are consistently legitimately good at governing. i'm way out here in left field, and i have the usual criticisms, but for capitalists? with all their flaws, true enough? there's a level of justified confidence in the party that i think pretty much every major industrialized country has lost, in their center-left.

https://www.theglobeandmail.com/news/politics/trudeau-says-women-who-speak-up-about-sexual-harassment-must-be-believed/article37760006/

jagmeet singh must cut his beard.
here's an idea that might actually work, regarding daca. you'll excuse my cynicism, but it's called for.

this is what you need to do: ambush paul ryan somewhere in public - a press conference, or a speech - and pointedly ask him the question that is really at the crux of the issue:

what kind of lobbying sum is required to get you to put the dream act on the floor? what's your price?

then, crowd source the cost and pay it out.

because this is the truth: nothing gets through congress unless it's paid for. the cost may be high. but, let me tell you: congressional leaders will surely change their tune, if you name them the right price.

right now, we're using crowd sourcing to elect politicians. maybe we should think about using it to control them with. and, after a few pay outs, they'll get the hint: these are bribes that they can actually win elections with.

jagmeet singh must cut his beard.
so, what am i doing, anyways?

from a distance, it probably seems like i've just fallen through the ground and into a rabbit hole, as i was prancing through the rhetorical field of rhetoric.

yes, the rhetorical field of rhetoric. it's a rhetorical field, remember. of rhetoric.

i think christmas is going to end in the next few days. yeah, it's a long one this year. well, i wanted to deal with all of the alter-reality writing - from 12/1996 to 02/1998 and counting - and, as those who have been following this for a while know, my writing tends to get a little more expansive on, err, holidays.

yes, friday is a holiday. legally. really.

so, i've been maintaining the proper mindset, notwithstanding tolerance, since christmas, preparing myself for the writing in the alter-reality...

....and i actually haven't even started yet.

as we can see, i've ranted here quite a bit, and quite nicely, since the 15th of january, when i closed the audio for the first two periods. today, i've been ranting nearly non-stop for like 18 hours or something - although i'm just about to stop. so, i've done a lot of writing, even if it's not in the topic i was intending. but, what i'm really doing is building a master list of album notes, so that i can pull the parts out that i need as i run through the alter-reality and close.

i need to reiterate that i only have to do this once and that, once it is done, the remaining process wil be much, much smoother.

so, what have i done over the last week?

i've built the first 350 pages of the master list up. the document is currently 700 pages, and has notes going to mid 2015 in it.

at this point, i would guess that the final document (1996-2018) will be around 3000 pages long - word, 8.5"x12", 12 pt - although i only expect to get up to around 1000 by the time i get to actually writing.

which will be when?

march.

christmas will be over before january is.

jagmeet singh must cut his beard.

oh, and, if it's unclear, the end of qe, combined with the ridiculous tax cuts, means that there will not be a trillion dollar infrastructure bill in the united states - or likely to be any government stimulus over the next several years at all.

jagmeet singh must cut his beard
neither party wants to pass this bill.

so, trump floated a ridiculous offer, and the democrats provided a ridiculous response. now, they can credibly blame each other for being ridiculous, and people will buy into it without seeing themselves in the mirror for the literal clowns that they are.

both of these positions are ridiculous.

i would have liked to see this passed in congress. the votes are there, if the speaker would just let it come to the floor. but, trump will reauthorize the order in march, and in the process have himself a good excuse for not building a wall - the democrats won't let him do it.

never mind that he controls the entire government - the democrats won't let him do it.

https://www.bloomberg.com/news/articles/2018-01-25/trump-would-double-daca-to-1-8-million-give-path-to-citizenship

jagmeet singh must cut his beard.
no, i'm not shy about this, i've posted it here before, albeit maybe not in a cohesive argument.

if america were serious about immigration reform, what it would do is dismantle ice and redirect the funding to a regulatory body that ensures that employers follow proper hiring practices, and face serious consequences if they don't. i will argue strenuously that, yes, it is an employer's responsibility to determine that their employees are legally allowed to work in the country, and that they should face severe punishment if they are caught breaking that law.

like, jail time.

this is the actual problem: the labour laws aren't being followed, and absolutely nobody is doing anything to ensure that they are. the debate is entirely on the migrants, which is totally backwards.

but, america is not serious about immigration reform. the democrats take their massive checks from their big donors, and look the other way as they exploit workers that literally have absolutely no rights, then argue it should be easier for those corporate donors to exploit those workers. the republicans also look the other way, but they scapegoat them like they're jews in order to quell dissent from the native born population and win votes. neither party has any vested interest in changing the status quo at all; it's just all political theatre on both sides, with no intent to change anything.

i think that nobody is illegal, and free mobility should be universal - globally. but, until we can get rid of capital altogether, the viability of such a system relies on a violent enforcement of labour regulations. migrants deserve a living wage, like everybody else - and native born workers deserve the rights to a collective bargaining process that prevents migrants from undercutting their wages...

there are thousands of immigration officers working for ice. redeploy them to go after the businesses. you'll see immediate results.

but, it will never happen, because nobody wants the status quo to be altered.

jagmeet singh must cut his beard.
actually, i'm glad i'm getting the opportunity to live blog america's fall.

it's kind of a wet dream for an asexual, actually.

no, really.

i mean, it's inevitable. but i didn't think i'd get to see it.

or gloat about it.

jagmeet singh must cut his beard.
so, after turkey, who will be the next us ally to bail on america, both for it's shrinking influence and it's dishonest provocations?

the germans will move once the gates are open, and that will likely be the point of no return. they are slowly, but surely, moving to align themselves more closely with the russians.

i'm going with japan as the second major defection, spurred on by annoyance over the tpp and the desire to tap into the chinese market, which is rapidly increasing it's amount of disposable income. and, they will take the south koreans with them.

the sun will set on the american empire.

http://www.hurriyetdailynews.com/china-says-it-hopes-to-get-japan-ties-back-on-track-126409

https://www.bloomberg.com/news/articles/2018-01-28/china-sees-obstacles-to-repairing-ties-with-japan-as-envoys-meet

https://www.rferl.org/a/nord-stream-2-u-s-poland-oppose-russia-germany/29002097.html

jagmeet singh must cut his beard
i will accept the argument that qe might have an effect in preventing deflation, which is what you would actually expect in a situation where:

1) the money is trickling up.
2) the population is increasing.
3) the money supply is stagnant.

in that situation, more mouths to feed and less money to go around should lead to deflation, as people have less to spend - or it least it should under market conditions. and, people are probably actually going to mark the food down if people can't pay for it, yes.

the elite might not care, except that the corollary of such a situation is civil unrest, and that's likely the actual reason underlying the policy.

but, it also cuts to the criticism that obama's stimulus was too small. i mean, i'm sure he had lots of political discussions about the size of the stimulus, and how it might be a liability for fiscally conservative democrats. but, the numbers picked were lower than suggested - and lower than the near simultaneous stimulus announced by the chinese, who seem to have been legitimately concerned about growth.

america's stimulus seems to have rather been about preventing deflation. meaning that this qe was just designed to stop the ship from sinking, not get it up and sailing again. meaning that even if you have faith in the market to set things right once the government has intervened, a faith borne out of zero evidence, and a faith that i do not hold, it still follows that the stimulus that is being withdrawn was too small to put the market on the right footing, in the first place.

to be clear: i'm going to argue that the economy needs stimulus all of the time, no matter what and that qe should be permanent. more moderate keynesians will suggest that the government only needs to intervene when investment dries up, and that once the economy is back on it's feet, the stimulus can be withdrawn. ok. but, even those that accept the more moderate position are mostly going to argue that the stimulus was too small to get the economy back on it's feet, and was really only enough to put off the inevitable deflationary spiral that going bareback for too long will inevitably produce.

this is bad policy, all around. and, i know the business press has it's head stuck up it's ass. but wait for it.

this is the reason that they tell you that leftists don't understand the economy.

jagmeet singh must cut his beard.
i guess i missed this.

when the economy crashes in a year or two, this will be the reason why, and not the tax cuts. america could go to a 0% federal tax rate without affecting the economy, so long as it prints what it needs - and can find somebody to buy the debt. but, when the country stops printing money, the economy will always start falling apart before the next election happens. it's a very short time window before the effects are felt.

"capitalism requires capital!".

and, perhaps it really is that simple. but, you can make this argument a dozen different ways...

i mean, i could run through the mmt charts.

but, i think even something as simple as population growth is a reason for permanent quantitative easing. and, maybe nobody has presented this to you, this way. i'm always surprised by how many activists sound like ron paul, when the topic of banks come up - probably because it's the only information they've ever received on the topic.

just think it through.

every given year, the following things happen:

1) the number of people in the country increases.
2) the value of the dollar decreases relative to itself (this is called inflation).

so, just through simple population increases, a roughly fixed money supply would mean that, year-over-year, there is going to be less money to go around, and it will be worth less. so, gdp per capita has nowhere to go but down.

now, you can argue inflation can be minimized (and i'm not going to take your arguments seriously, as there is no evidence at all that quantitative easing does cause inflation, despite many attempts to force it to; it's usually the reason it's brought in...) by reducing the money supply, or eliminating the ability to manipulate it, but you can't make that argument about population growth. if you don't increase the money supply to compensate for population growth, you're going to run out of money; if you have x dollars, and you split it fairly amongst y people, you're going to need a lot more than x dollars to split it just as fairly amongst y^2 people, and if you only have x dollars then the result is going to be a recession...

you won't find that in a textbook, but it's maybe the easiest way to understand the necessity of qe in the existing capitalist economy - and the sheer logic underlying the policy.

https://www.ft.com/content/caf45d6a-9e28-11e7-8cd4-932067fbf946

jagmeet singh must cut his beard.
yeah.

the tax cuts won't do much at all, but the end of quantitative easing is certainly going to kickstart a recession. the american form of capitalism requires quantitative easing, and will collapse without it. or, at least that's what empiricism teaches us.

i actually didn't expect that from trump, and hope the article is reaching a little. i expected him to throw money around all over the place, and print what he needed. tax cuts. boosts in military spending. how do you make up the difference? i guess i assumed that trump would walk down the same path as reagan: truly believe that government is spending too much on poor people and not enough on guns, then cut everything you possibly can besides the guns, then realize the government barely spends any money on poor people at all and is actually spending all it's money on guns and so instead just print even more money for the guns, without bothering to restore funding to poor people. that's how republicans do this, right?

and, we got the expected bill. i mean, maybe that's why i didn't bother to analyse it or even read it - it's exactly what i expected. we got the military increases. we got the tax cuts. we got the slashing of services. the next thing that a republican is supposed to do is print the money to offset the tax cuts...

again: maybe he still will. maybe this is reaching.

but, he did just replace the fed chair.

and, i did tell you he was going to dismantle the empire.

what happens after quantitative easing stops is going to look a lot like the end days of the soviet union for a lot of people, even if it doesn't lead to political reform - or at least not immediately.

https://www.theguardian.com/business/2018/jan/26/imf-chief-warns-trumps-tax-cuts-could-destabilise-global-economy

jagmeet singh must cut his beard.
in case i haven't been clear: i would have voted against brexit, for the reason that it's not likely to actually solve anything. the same bankers end up in control, in the end. it's going to be mostly smoke and mirrors, by the time it's done. but, now that it is upon britain, i think there's certainly a lot of tweaks that could be made to improve the condition of the british working class. i guess you could say i would have been in favour of renegotiating terms, rather than fully withdrawing.

i don't expect this to turn out to my liking. i guess that's the other reason i would have voted against it.

on an issue by issue basis...

1) free movement of goods: no. get rid of that.
2) free movement of capital: no. get rid of that.
3) free movement of labour: yes. maintain this.
4) customs union: no. get rid of that.

what will actually happen, probably?

1) free movement of goods: this will likely be restricted.
2) free movement of capital: this will likely be maintained.
3) free movement of labour: this will likely be restricted dramatically.
4) customs union: the british will likely synchronize their tariffs, one way or the other.

but, that doesn't mean i can't agitate.

jagmeet singh must cut his beard.
thank god* for vice news.

https://www.vice.com/en_uk/article/gq9m9j/he-left-wing-arguments-on-the-eu-referendum-brexit-for-against

jagmeet singh must cut his beard.

*clearly, there is no such thing as god.
see, i think labour ought to be using the xenophobia as a wedge issue. if it becomes the ballot question, it could both help ukip split the vote and increase the turnout by both creating a movement amongst often non-voters and really riling up the base.

it requires some careful framing, but there's no issue more populist than fighting xenophobia.

maybe some hard numbers from internal polling might make me rethink it. but, if it were me, my thought process would be something like "what do i care if i piss off some white trash tory voters?".

i know, not very statespersonlike. whatever. politics is a dirty business.

https://www.theguardian.com/commentisfree/2017/dec/12/brexit-jeremy-corbyn-keir-starmer-labour

jagmeet singh must cut his beard.
yeah, i can't imagine the british signing up to a system that they pay into without have voting powers, given that they still like to pretend they're a colonial power. they couldn't deal with that.

i mean, they have a veto at the united nations. you're going to tell them they can't vote on cheese tariffs?

the canada-style deal is, indeed, the better option, but i don't agree that the single market is an indivisible idea. i don't see any reason why corbyn can't push for the free flow of labour, while denying the free flow of goods and capital. i mean, he's in opposition, he can be a little loud about something that might be hard to negotiate, right?

i think he might find that this liberal opposition he's facing is mostly concerned about britain losing it's cosmopolitan character, rather than about the economics of the situation. and, so long as demand settles, brexit shouldn't directly harm the british economy, once production relocates or transforms itself accordingly to meet demand. job losses is what the establishment always says when it's facing a backlash. we can't get rid of oil, because jobs. we can't get rid of war, because jobs. so why is it a surprise that we can't get rid of the eu, because jobs? and it shouldn't be a surprise when that turns out to be the same old contrived bullshit, either. jobs are created by demand...

britain was key in the industrial revolution, remember. this was a society that was built on the strength of exports to foreign markets (often opened with gun boats). but, if they're going to bring production back, maybe they can clean it up this time. and, maybe it could even act as a model for a new industrial revolution, to sustainability.

if i'm right, and the opposition to brexit is more cultural than economic, while the support for brexit is mostly economic, he can probably get away with opposing brexit on cultural terms and supporting it on economic ones, if he just focuses his agitation on that one point of maintaining free mobility, if he can win the argument that the real cause of migrants stealing jobs is employers that don't follow labour laws.

it's lonely out here on the left, sometimes. this probably sounds delusional, even if i'm right, as i usually am.

http://www.telegraph.co.uk/politics/2018/01/27/canada-style-brexit-deal-obvious-rapid-solution/

jagmeet singh must cut his beard.
let's not go back in time and talk about andrew jackson, who, excluding washington, was probably the closest thing america has had to a king.

the real demographic split hasn't changed, not through all the shifts in american history, not through slavery, not through civil rights - the democrats remain the party of the educated elite, while the republicans generate the bulk of their support from the masses. you can pull out different alliances. but, you're more likely to meet a democrat at a high gala event, whereas you're more likely to meet a republican in a small town working class tavern.

because this was always the real divide in british politics: between the party of the court and the party of the people.


jagmeet singh must cut his beard.
it's just...

after decades of having the socialist party overrun by liberals, the party membership finally gets it's machinery back, maybe, at least it finally has somebody that has left-leaning instincts, and as soon as he makes a stand in favour of native workers, he has to deal with protest from liberals inside his own party.

they're in the wrong party.

they're liberals.

tell 'em to piss off, and to go back where they came from...


jagmeet singh must cut his beard.

for those that don't follow british politics...

there was of course a liberal party in britain back in the day, from which both the canadian liberal party and the american republican party claim ultimate descent, with the republicans doing so through the whigs. the democrats can't really claim historical descent from the conservative party, but they have usually been more like conservatives than liberals. in traditional british politics, blue means right-wing (with it's monarchist tendencies) and red means left-wing (this is of the people), so long as we're not eating bread at the circus, in which case they're both the same, anyways..

somebody might get me on a technicality, but i believe that the last liberal prime minister of the united kingdom was neville chamberlin, who casual readers of history no doubt know solely through his fascist appeasement policies and subsequent declaration of war against germany in 1939. the brits never forgave him for this, and the liberals were replaced by labour - a socialist party - after the war. the early years of ingsoc had some positive influence in britain, as well - even if the most socialist thing they did was allow the empire to collapse without a fight.

the liberals sputtered for decades, after that, before merging with a smaller party in i believe the 80s to form the liberal democrats. but, this is basically the continuation of the party of gladstone. it's still there, man.

this is where the remainers ought to vote, if they want to uphold the neo-liberal status quo. and, it's rational. you want liberalism? vote liberal.

that should be the campaign slogan. at the end of the ads.

are you a liberal? then vote Liberal.

http://www.independent.co.uk/news/uk/politics/liberal-democrats-challenge-labour-european-single-market-vote-parliament-brexit-latest-a7915106.html

jagmeet singh must cut his beard.
it's some serious mental gymnastics to argue that opposing a free trade deal, and not supporting a single market, is in some way a betrayal of socialist values.

the british didn't lose their liberal party, it just fell into disuse. but, this is a good reason to bring it back. and, that is what i would say to the remainers: if you're so in love with neo-liberalism, why don't you marry it? why don't you join the liberal party?

i understand that the party wants to win elections. but, they really ought to take a stand on this, and go tell these liberals to be liberals, and stop the doublespeak around the situation. there's not a socialist on the planet that supports the euro. i mean a lot of us don't even support the concept of currency.

that said, there are aspects of the eurozone that most socialists would support, and that activists should be pushing labour to try and maintain some kind of continuity on. free mobility, for example, is certainly a socialist aim. i understand that the push back was largely about open immigration, and what the british people really said was that barely half of the people that voted wanted to restore some sovereignty around immigration. so, there's a large minority of voters that want less immigration. but, as a long-time opponent of nafta, i actually think that one of the major problems of nafta - that it created a lot of economic migrants - would be best solved with the kind of mobility rights that exist in the european union. i mean, that would be one of my major fixes for nafta: it should have eu-style free mobility. i've made that argument forcefully, for years. not decades, but maybe a decade. such free mobility would actually make it easier for workers to be tracked as they cross borders and harder for unscrupulous employers - which are the actual problem - to evade labour laws. what the british people are going to see, in the event of stricter limits on immigration, is a situation more comparable to the southern parts of the united states, where illegal migrants work without legal protections and under the table. employers will benefit. but this is going to actually exacerbate the economic problems that created the backlash vote in the first place. labour ought to be trying to win this argument, but, instead, they're not making it.

socialists, however, are not concerned about things like religious freedom, as we seek to abolish religion, and multiculturalism, as we seek to abolish nationalism. this is all boiler-plate liberal bullshit. so, these people should be told where they ought to go with it.

jagmeet singh must cut his beard.
and, should america be angry with the turks for their betrayal?

the turks have actually been very compliant allies, and they had to be, because they were all of a sudden back to where they were in the fourteenth century, and under imminent threat of russian invasion of the dardanelles. there was a war in greece over this, right after world war two. without western support, turkey would have certainly become a soviet socialist republic. it was the first major proxy conflict of the cold war.

and, since then, turkey has been compliant because they've been reliant. i've gone through great lengths here to stress turkey's role as a european power, and one half of the legacy of the byzantine empire - the geographic half, if not the cultural half. hey, listen - the turkish emperors themselves were well aware of this, and picked up where the romans left off, launching multiple invasions of rome to try and unite the empire.

historical reality is that if the turks had succeeded in conquering italy, they would have almost certainly moved their capital to rome, and what i'm saying here would be mainstream history, although it's not particularly obscure, as it is.

the turks demonstrated every inclination that they wanted to be an important part of the western alliance, from the embrace of secularism to the construction of important nato military facilities. they've fought and died in western wars.

but, now, we see what america has done - and this is obama's fault - to spit in the face of this willing and compliant ally, in backing extremists funded by the saudi theocracy to redraw the maps in the middle east, in ways that put the very premise of turkish civilization under existential threat. much of the fighting in the syrian war was between turkish-backed groups and saudi-backed groups for control over who gets to recreate syria in their image, in the then-perceived vacuum of russian power, with the americans overwhelmingly supporting the saudi-backed groups, which convincingly defeated the turkish-backed groups, before the russians came in and beat the saudi-backed groups. the turks have been fighting a proxy war against deep american interests the whole time! it may have taken them a few years to understand this, as no doubt nobody told them. so, some allies. america has refused to take these concerns seriously, to the point that it has essentially been treating turkey like an adversary - just another bunch of barbarians to divide and set at each other.

erdogan is dumb as a plank, but he's right about this: this is not the behaviour of an ally. it is the behaviour of an imperial force set on setting everybody against each other. the turks do not have real friends or serious allies in washington.

to put it another way, turkey may have demonstrated enthusiastic willingness to be in the empire, but the empire has refused to consolidate turkey within it, instead seeing them as outsiders - barbarians with weird customs that need to be kept in a state of inter-warfare to prevent them from challenging american interests. america would be just as happy to see turkey collapse into a set of buffer states.

no, do not blame turkey. this is america's fault.

and, it's america's addiction to oil's fault.

jagmeet singh must cut his beard.

Saturday, January 27, 2018

woah.

listen.....

what the russians want is clear enough: they want to return territorial sovereignty to syria, to recreate the sykes-picot lines and return the map to what it was before the mess started. the americans are obviously arming the kurds because they don't want to do that, they want the map erased and redrawn, to reflect what their arab allies believe is a better understanding of demography and history. for, the sykes-picot lines were clearly arbitrary.

lets try a thought experiment: what if the americans had succeeded in using these extremists to overthrow assad? the kurds would have been abandoned immediately, or at least expelled to an enclave in the north. the whole point of this was to back saudi ambitions for a pan-arabic, fundamentalist state; the kurds would not be welcome in such a hypothetical society. it's not the middle ages, any more. the end result would have been the abolition of national boundaries in the region, and perhaps a kurdish state centred around mosul. certainly, the americans never planned for the kurds to move into syria, it's just something that kind of happened, largely in reaction to the russians setting up. the americans found themselves in a race to occupy as much of the country as possible.

so, when the russians told the kurdish militants "hand the region back to assad or be driven out.", it was done with the intent to re-establish the international rule of law, and reconstruct the nation state of syria, with a capital in damascus.

the russians are up against a wall in terms of what they can actually do. if the status quo persists, there is a real threat of syria fracturing like korea and vietnam did in the cold war, and the kurdish enclave becoming an american military base, like south korea is. notwithstanding the fact that this would be bad for syria, it is not in russian interests to split syria down the middle like this. but, they can't act directly against america, either.

the turks are in charge of doing this precisely because it won't set off a world war, due to the close alliance with washington; ankara can get away with things that moscow cannot. and, their task appears to be to set up a buffer zone separating russian and american forces, thereby allowing the regime to consolidate the regions behind the buffer zone, and ultimately prepare to reunite the country.

jagmeet singh must cut his beard
my initial reaction to trump skipping out on the tpp was something like:

he has no understanding of what he's doing, but if he wants to go ahead and accelerate the decline of america as an empire, i'm not going to put up much of a fight.

this reaction is repeating itself around the world.

and, as i predicted in 2016, trump is, indeed, in the process of unravelling this empire.

it's not entirely his fault. all of these things were put in motion under obama. but, he is an example of the perils of electing exactly the wrong leader at exactly the wrong time. and, the results will reverberate across the centuries.

jagmeet singh must cut his beard.
For his part, Aldar Khalil, the co-chair of the Movement of a Democratic Society in Afrin, has been quite vocal about Moscow’s strategy. “Syrian Kurdish forces were given an ultimatum over the weekend,” Khalil said.  “[We were told] leave your positions to the Syrian regime or face the wrath of Ankara. They chose to stay." 

activists on the ground: yes, turkey is still in nato. but, it's a formality, at this point.

the turks are currently actively acting against american interests, and actively aligning with the russians.

i know that you're used to seeing nato as this monolithic thing, where orders are barked from washington. but, this started to break down in the bush administration, was band-aid-ed over by obama, even as he put events in motion that would ultimately weaken american leadership, and has now completely imploded, fairly quickly, under trump. the return of russian power is a consequence of a lack of american leadership, more so than it is a complicating factor.

a return to a multipolar world doesn't and shouldn't change basic political allegiances, and the rojava are certainly worth standing in solidarity with, whatever their flaws. but, it calls for a sharper analysis and a more careful attention to details.

the old alliances are just that, now: old alliances. and, turkey's re-alignment is likely the beginning of things, rather than an isolated happening.

the turks have reason to align with the persian empire - and the kurds are likely the power that will return the persians to empire, one day. but, the russians cannot align with the persians, these are historically competitive empires. they can dominate the persians, they can act as a counter-balance to american interests, and etc. but, the russians must ultimately seek to reduce persian power, and are already opening up a potential pandora's box in doing what they're already doing. when america is gone, the byzantine-persian conflict will persist. the russians have an existential stake in ensuring that they remain the dominant power in that relationship.

i'm just requesting that people be careful enough in their analysis to adjust to the shifting realities, as this is a real thing that is happening, and is likely to accelerate.

so, could we lose america before we lose capitalism? is that what is ruffling these old leftists, who have identified the two things as the same thing? how is this possible?

i will tell you, authoritatively: we will lose america before we lose capitalism, america will not be where the revolution takes place and america will not be the society that leads us into socialism, or into communism. capitalism will not be the same, without america. but, america only has itself to blame for it's decline. and, that decline has been apparent, for decades.

so, this should not shock any old leftists at all. it's just a question of realizing what's happening.

jagmeet singh must cut his beard.
the evidence *is* fairly clear that stimulus works, and tax cuts don't. i mean, this shouldn't be an ideological debate. and, it is trump that is living in the world of economic unicorns, holding to ideas that don't just lack empirical support, but have been demonstrably proven as ineffective - while trudeau is really holding to the textbook on economics, here: growth is driven by increases in aggregate demand. wage increases are far more effective than tax cuts in increasing this.

trudeau is right, here. trump isn't.

but, there was a poll that said that the conservative party propaganda - a
nd that is what it is - about harper being a strong economic leader has had some kind of brainwashing effect, so here comes good old lorne hunter to enforce the lies. this isn't actually news, though. harper was outpolling trudeau on the economy right up to the election, remember, and still lost. you started seeing the numbers diverge when the ndp was leading: harper consistently did the best on the economy, but was still losing in every poll. how do you explain that? my analysis of this at the time is that people didn't really understand what they were telling pollsters, they were just repeating the marketing. the tv says harper is better on the economy, so he must be, right? but, if you try and ask them to explain *why*, you're not even going to get a coherent answer at all, let alone a confused one. they've never really thought about it, they're just taking the commercials on tv as an authority. because the tv doesn't lie, right?

i actually think that the oversaturation to economic messaging from the conservatives has probably led to a kind of ultra-paradoxical phase: they may accept that the conservatives are better on the economy without knowing what that means, they might obediently repeat the propaganda, but that doesn't appear to be affecting voting decisions, at this point, because they don't actually understand what the conservative party means when they say they're best on the economy. so, they take it as a given, but they don't understand what it actually means. i mean, this isn't an accident: the party obscures bad policies with vague messaging that obscures what they're actually doing. so, voters seem to be having difficulty tying the propaganda to actual policies, and then realize they don't support the policies that are apparently so good for the economy when presented with them. but, they repeat it, when polled on it, anyways.

i would suggest that the effects of this are going to be that the younger generation is not going to put the economy at the top of their voting priorities, and that's a deep social change. but, it's a reaction to the conservative propaganda. and, the country could very well end up economically better off as a consequence of it.

i kept asking steve if his economic action plan was a four-year plan or a five-year plan, and i never got an answer. but, i guess he had a majority for four years, right?


 http://torontosun.com/opinion/columnists/gunter-trudeau-stakes-our-future-on-hipster-economics

jagmeet singh must cut his beard.
it's starting to look like the aristocrat swooping in is caroline mulroney.

that's a dramatic entrance to high level politics, for somebody that one might assume ought to run in quebec.

it will be interesting to see how this unfolds. i do believe that she has an existing media footprint, and would no doubt be used by the tory elites as a front, managed through that media image - you could call it the trudeau model. but, i have my doubts about the applicability of the trudeau model to provincial politics, where turnout is lower and voters tend to be more informed.

i'd like to see them try this, really - because i don't think it will work. not a mulroney. not in ontario. but, what an experiment...

to be clear: who knows if what happened will ever come out in the form of actual evidence, but a little deductive reasoning is suggesting that the way has been paved for mulroney to move in, as the preferred option of the party executive, which wants to manage the office ceremonially and pull actual decision making into the party executive. well, the liberals just did it, federally. and, it's working.

it's of course going to be the excuse to wipe patrick brown's platform away, as well. new leader, new ideas. if the tories veer right and lose the election, as they always do, this is going to be a question that people will ask: might they had won with patrick brown and his platform? if they hadn't got cocky...

i dunno. i'm a logician, not a clairvoyant. and, we're going to need to wait for the dust to settle before we even look for a signal. but, if what appears to be happening is what is happening, i think it's going to backfire: i think the mulroney name is going to backfire, and i think people aren't going to take her seriously as an applicant to the premier's office.

jagmeet singh must cut his beard.

Friday, January 26, 2018

i think that the point that he's making is actually that the undrip is likely to be declared unconstitutional in canada, but he's lost himself down the unlikely path that occurs when the courts interpret international law as of greater importance than constitutional law, which is a non-starter, and not in their mandate.

it follows that the liberals can go ahead and support this bill, in order to avoid the optics of opposing it because it will amount to little. i wouldn't expect anybody to go through the formal process of striking anything down. and, it also follows that what romeo saganash ought to be pressing for is an opening up of the constitution, because that is the level of law that needs to be addressed in order to implement undrip in canada - at least rigorously.

a private member's bill like this is really equivalent to a non-binding resolution. and, everybody involved in putting it together is fully aware of it.

i want to be clear: the canadian constitution has specific provisions for indigenous rights, and they have been developed by the courts over the last several decades. that is the law that the canadian judicial system will defer to and, in the presence of any contradictions, any international law reintroduced as domestic law would be declared null. for, that is what a private member's bill is - domestic legislation, subject to constitutional challenge. but, the unconstitutionality of the document doesn't come in a void, in canada. we already have a legal mechanism in place.

the article is basically right - bringing in the undrip would cause havoc on the judicial system. but, the judicial system is neither obligated nor likely to accept this interference into the independence of the judiciary; the fact that it would cause havoc is why it won't happen.

we've been seeing this undrip thing play out for years, though. it's a dead end, in canadian law, and everybody has to understand that, so it all seems kind of fishy. in fact, the constitutional discussions held during the meech lake accords (which the push for undrip has erased from activist memory) explored a lot of the same issues being looked at in the undrip, and would provide a far better starting point for serious legislative action.

opening up the constitution won't be easy. but, it will be the only way to fundamentally change the legal framework overseeing the project of canadian imperialism; these private members bills, they do nothing. the process unfolding in the courts may lead to greater and greater amounts of compensation and local democracy around specific settlements, but it will ultimately maintain the allodial land rights of the crown to make decisions, made or not, to exploit the land. to change that is too deeply embedded in our laws for it to change by a declaration in the house. that is a constitutional level of change, in canada.

http://business.financialpost.com/opinion/the-trudeau-government-signs-on-to-give-aboriginals-veto-rights-nobody-else-has

jagmeet singh must cut his beard.
so, those girls weren't legally underage for sexual consent, although one was underage for drinking. it's a technical twist that ought to matter but ultimately doesn't. it's crass enough behaviour to be disqualified from public office.

and, as to the precise question of his resignation, his guilt isn't even a factor - he was asked to resign because of the distraction the allegations would create around the campaign. he should be free to run in the upcoming leadership campaign, should the accusations be demonstrated frivolous in due time. it's just that this narrative around due process is missing the point; he is being asked to resign so that he can go through with his due process in a way that is severed from the party that is running for office. he can't be asked to do both things simultaneously, and the public can't be asked to multitask on that level.

could that happen to anyone? well, yeah. and, anyone that it might happen to ought to be entitled to a leave of absence to attempt to clear their names of charges. but, a running premier can't take a leave of absence, so he must be dismissed instead.

the fact that he might be likely to defeat the charges is immaterial in the decision. politics is hard.

but, if this is truly frivolous, who might be responsible for it?

well, i think it was ultimately the democrats that took out al franken. might somebody in the conservative party be watching too much game of thrones? well, it's a plum position to be in, in a potential backlash election. a coveted spot. might somebody more powerful have taken it away from him? or, maybe it was a disgruntled group of hard right conservatives that wanted to stop brown from steering the party into the centre...

of course, it might have been kathleen wynne. that would be a sneaky move. and, invite retaliation - and a potentially stronger opponent.

i'm not sure the motives add up for any of the suspects, here, besides a usurpation from above. and, if true, i suppose a potential suspect will make itself known, in time.

jagmeet singh must cut his beard.

Thursday, January 25, 2018

i thought about this, and i actually think the ndp would have a bigger pull under the imminent threat of a conservative win.

the conservatives will have a new leader in place before the election. patrick brown is off the ballot, but the party will still be on it. so, those people that are trained to vote for the conservative logo as a default replacement option will still be able to do so, and if the vote is explicitly against wynne then the replacement of brown should change little in the decision making process.

i'm not convinced that the backlash is so strong, right now. all of those polls had very high numbers of undecideds. but, there is no real reason to think a change in leadership will prevent it, if it is. andrea horwath has been there the whole time; the people that are singularly irate with wynne would already be leaning ndp, if they were so inclined.

i mean,  the article is written as though brown is taking the entire conservative party out of the election, and the ndp are the only other option left standing. that's not an approximation of reality at all.

wynne is more likely to use this to appeal to centrist voters concerned about stability. the tories need to get their own party in order before they can start considering forming a government, kind of thing.

https://www.thestar.com/opinion/star-columnists/2018/01/25/patrick-brown-sex-scandal-boosts-fortunes-of-andrea-horwath-and-the-ndp.html

jagmeet singh must cut his beard.
i think that fallout from the patrick brown situation is unclear; if you're the liberals, this is almost an act of god, and it's really just out of nowhere...

one substantive factor likely lies in how the conservative base reacts to it on social media and in conversation. the party might take swift actions to try and neutralize what it sees as a nightmare, in an attempt to appeal to...sane people, really. but, you know that the good old conservative base is going to yell and scream about feminism, and how he was set up by a clique of feminazis trying to silence him.

i'm not suggesting that such a movement has legs. not in ontario. not in 2017. but, these idiots are vocal, and this is the kind of troll that they love to get in people's faces on - and that people get pissy about, quickly. here's your free market, guys - you have no control over how your voters represent your image on social media, which is the media people actually use.

avoid your uncle on facebook this week.

and, the accusations are....they're substantive because she was underage. but, that's one of the arguments that the mras love to go to town with, isn't it? "i thought she was legal. how am i supposed to know?".

but, the candidates will address their opponents, and soon enough be eager to push patrick brown out of the news cycle. wynne probably wins by default, now. but, that zombie conservative vote really is stubborn, you know.
just so it's clear, the text at astana was largely written by the russians - and the americans weren't invited. i suppose it doesn't alter complicity. but, not only is this attack not nato-sanctioned, it's russian-orchestrated.

Wednesday, January 24, 2018

Osmund Cooke
Not sure if I was listening carefully, but can an enzyme split an atom and create nuclear fission?
Something like oxidoreductase or acid base catalysis

deathtokoalas
i believe you can find evidence for your hypothesis in the phenomenon of explosive diarrhoea.

this idea in the anti-gmo movement that you can absorb modified dna somehow is science fiction. organisms can steal dna from other organisms, but it is something that becomes less and less feasible as life becomes more and more complex.

what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.

maybe some diagrams might help.

suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata

your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata

your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.

so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.

there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.

jagmeet sing must cut his beard.
an opportunity, perhaps, but, as justin is not his father, this is not the ndp of the 60s or the 70s, either. i frankly don't think they have the credibility on the left to put up a believable opposition to free trade. this is where the ghost of mulcair appears and haunts the ndp forever, as he was very tepid in his criticism of the tpp, and projected fairly clearly that he intended to support it if he had won in 2015. if i am correct that jagmeet singh is a creature of the ndp leadership, it's not even clear what the actual policy position even is, let alone if they can lead an opposition movement that is, issue-by-issue, well to the left of where the party currently sits.

in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.

i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...

https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html

jagmeet singh must cut his beard.
but, what would you do if you were free?

i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.

see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.

immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.

unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.

because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.

so, what would you do if you were free?

then, do it.

jagmeet singh must cut his beard.

Tuesday, January 23, 2018

so, they signed the tpp.

i would have rather seen a bilateral deal with japan...

why didn't they sign it previously? well, you'd think it probably had something to do with wanting to wait to see what was happening in the united states. a canadian entrance into the tpp could have severely complicated nafta talks.

and, the timing of signing on to the deal is no doubt informed by recent events around the nafta negotiation. that may seem ominous, but i think you can also read it the other way - the liberals may have calculated that trump will not be able to re-open nafta in the face of congressional opposition by 2024, and that these talks will rather go on until trump leaves or is removed from the white house. they may also have calculated that the united states will return to the tpp in 2022 or 2026.

the standard narrative is going to be that it's a pre-emptive reaction to the imminent collapse of nafta, but the facts would hardly uphold it. two-way trade is really only going to exist with japan and perhaps australia; the rest of the countries are going to act as...

trump thinks that the tpp is a backdoor for china. it's crazy. the tpp is the exact opposite: it's the reconstruction of the wartime japanese empire, to act as a counter-balance to contain the chinese with. so, the bulk of these countries exist in the deal to provide natural resources and labour to japanese multinationals, who will then sell the products in north america - or at least in canada. the labour provisions in the agreement are a joke, really.

then, you've got singapore for money laundering and other banking functions.

how is that going to replace nafta? the japanese market for beef is not that powerful, although the alberta farming lobby no doubt pushed hard for the deal.

it makes more sense to think that canada has made the choice to act independently of trump, for the reason that it doesn't have much faith in trump to chart a path, and rather has better reason to think the future will be designed by his opponents.

jagmeet singh must cut his beard.
i don't see any value in this liberal strategy to try and deflect from trudeau's privileged class status, not because it isn't in some sense a liability - and it should be stressed that this is an about-face from the glossy magazine photos that i criticized - but because it isn't believable.

everybody knows that justin trudeau is an aristocrat. so, attempts to deflect from or distort this seem like an attempt to construct a parallel reality, which i guess is only really an error insofar as it is so transparently fraudulent. they're just replacing one unbelievable narrative with another.

campaign rhetoric aside, no sane person thought justin trudeau was going to be a representative of the middle class, and that's not why he got elected. he was elected on a social liberalization platform, which was a bundle of ideas that included the right to wear scarves in public and the right to smoke up without going to jail. there was maybe some hope that he might bring in people that would help ensure our descendants have the right to live on a habitable planet, but these are the kinds of decisions that are made by corporate aristocrats, and the hope that he might have some influence was actually reliant on him using that elite status for influence.

i guess the cynical analysis is that the narrative shift is meant to accompany a policy shift that will align the liberals to the center-right, which is where they have tended to stabilize towards during long periods of safe governance, and where they've largely sat since coming back into office. they've tended to avoid this kind of messaging, but the recent absorption of the aging progressive conservative intelligentsia may be leading them to project phantom demographics into the future. that swing vote won't be replaced, when it dies, and it's almost dead; instead, you'll have a fundamental shift in the number of voters that call themselves 'liberals', because they always have been - and whether this is a 5% or 10% tipping point will determine if the conservative party is a viable vehicle moving into the future, and whether the ndp is a perpetual opposition party or not, as these no longer young voters have now overwritten their parents' conservative identity with their own liberal identity, and are consequently reachable from the left. the fact that the ndp is currently a distraction, at best, doesn't affect the demographics that are emerging.

in canada, that means a shift from a left that takes up 60-65% of the spectrum to a left that takes up 65-75% of it.

but, this is what happens to all liberal governments - they get some support from pragmatic conservatives at the beginning of their mandate, and then design their policies to try and appeal to conservative voters, then get confused when they crater on both sides, as those pragmatic conservatives still always prefer the conservatives, in the end.

if it were up to me, i would not be having trudeau making apologies for his status. i'd be having him demonstrate results to the cameras.

jagmeet singh must cut his beard.
the reasons trump is doing this don't have anything to do with workers; one might rather note trump's treatment of south korea as a chinese satellite with a level of alarm. but, it could very well provide incentives for korean and chinese businesses to manufacture more goods in the united states, which would indeed import some jobs from elsewhere into the united states. but, at what retaliatory cost is unclear.

i don't have any particular aversion to tariffs in principle, it's more that using them is a really tricky game that requires quite a bit of mathematical analysis and intelligent foresight - qualities the president does not have. tariffs should certainly not be used haphazardly as a hegemonic tool of control, but that box is already long open.

http://www.bbc.com/news/business-42784380

Monday, January 22, 2018

"I think if we've learned anything during this process, it's that a strategy to shut down the government over the issue of illegal immigration is something the American people didn't understand, and would not have understood in the future,"

indeed.

but, you understand it, mitch. so, at least until november, as the most high-ranking nominally sane republican congressional leader, it's your responsibility to thwart it.

jagmeet singh must cut his beard.
i'm not particularly comfortable about letting donald trump shut down the government, guys. even if unintentionally, it may be a test run.

it's responsible republicans that need to make sure that this shut down is of a short duration.

jagmeet singh must cut his beard.

Sunday, January 21, 2018

so, what is happening in the conflict between iran and saudi arabia, right now?

it's a civil war in the persian empire. and the jews are being a nuisance to the hegemon, as always. but, it's a war that the iranians must win in order to rebuild their empire, their civilization - which is why anybody interested in stunting the iranian return to empire, as the western empire has been since the great game, perhaps on the strength of elizabethen era intelligence from russian agents, who were loosely aligned with the british at that time, but why anybody interested in stunting the iranian return to empire would back the saudis in that civil war.

might the turks be even better off in the persian sphere than in the greco-russian one? well, iran could act as a sort of pass through for a larger turkic confederation, as modern iran also has substantial turkic roots. the mongols didn't bring a direct population replacement themselves, but they opened up a vacuum for turkish tribes to migrate into. the mongols mostly wanted to go home. while they no doubt left descendants as the children of rape victims, the semi-apocalyptic conditions that these children were left to fend for themselves in would have had a staggering mortality rate. with the collapse of the entire economy, it would have been difficult to find food. and, you consequently might have become food, yourself - at the hands of animals, or perhaps of other humans. i'm speculating; there are no detailed records from this period, everybody was killed. the reports we have are from people travelling through, and they're grisly, but not detailed. there are no grounds besides speculative logical ones to suggest that the persian victims of the mongols resorted to cannibalism, but they might have. you have to wonder how many rape victims took advantage of their misfortune; it's protein, why throw it away?

we can state this much as fact: there was enough empty space to allow for substantive migration into iran from central asia, which is how the turks got to turkey in the first place. and, mortality rates aside, it started to seem like everybody around there looked a little bit racially mixed, all at the same time, around this point.

for, when the persians conquered the romans from the inside out, they were really conquering the greeks, as the romans were in the process of the germanic revolution at this point. if the turks reunite with the russians to recreate the greeks, will they end up conquered by the persians again? does history not state that this is inevitable?

well, we haven't tried it with russia as a base. what we know about history regarding russia is that it is a useful hideout for pirates - thugs, barbarians, terrorists. with the empire now in direct control of the barbarians, it might have an easier time with the persians. how's that for a long game in history? how's that for process?

really, the difference is this: if the turks unite with the persian empire, it could set off a regional war between iranian and russian empires for what is greece - the dardanelles, and the old city of byzantium. the entrance into the black sea, which russia will always seek strategic control over. on the other hand, if the turks unite with the russians, it could lead to an uneasy peace between russia and iran, while the iranians fight their civil war - which is setting up a longer term struggle for the eastern mediterranean, that israel may well have expanded into during the kerfuffle. so, it's a question of positioning - do the turks want to give the advantage to the russians or to the iranians?

i'm sure they'd rather direct the conflict to the south, at least.

economically speaking, a union with russia would provide for far greater opportunities than one with iran, just due to russia's sheer size. russia is almost unique amongst nations in having the resources to be largely self-sufficient in most things, so the sanctions have been less damaging than they could be, or have been on iran, which pales in resources. they might prefer to give the russians the advantage, if they are concerned primarily about self-interest.

these are questions for turkish leadership to weigh.

jagmeet singh must cut his beard.
i want to show you where this community is on a map:


there are no roads into this community, which has to deal with frozen ground for a substantial amount of the year. it's surrounded by marshes and wetlands, with little agricultural support and no meaningful industry, except perhaps logging. i don't think there are mines in the wetlands of northwestern ontario, although there are quite a few to the south and to the east.

i want the natives to have access to modern amenities. but, their request amounts to building them a city that has no potential economic base. it doesn't matter what you put into a community like this, if it is so poorly geographically positioned that it has no economy. imports into the city are going to need to be expensive, because it is so far removed from existing infrastructure. so, the only way the city would be able to survive and grow would be through increasingly large government subsidies. it doesn't make any sense to walk down this path, and so no government will actually do it.

i think it's worth acknowledging that the low quality of the land in the reserve is the reason that it was put aside for indigenous people, who were then rounded up from the outlying areas and placed in it. nothing could grow here, anyways, so it's of no loss to put the indigenous people there. now, we are faced with the absurd consequences of an unjust policy, the building of an isolated city in the marshland wilderness, and need to re-examine it from the core.

i think that if the trudeau government, or any government, is serious about housing in remote reserves, it needs to lay it out for these people: there will never be running water or sewer systems or stable electricity in these regions, because it makes no sense to build cities where there is no potential for economic activity. governments should nonetheless commit and strive towards moving these people into modern housing in serviceable areas, which may mean indigenous neighbourhoods in semi-rural or suburban areas, but not these remote villages in virtually uninhabitable places.

the government says things to win votes. if it were serious, it would stop the charade. and, as long as the charade continues, it should be seen as disingenuous.

the government's assimilation policy is as old as the country. what i'm suggesting is actually not dissimilar to what the elder trudeau, and his sidekick, chretien, tried to do in the infamous white paper. the assimilation policy had largely been carried out...not in secret, but knowledge of it was need-to-know. an open secret, perhaps. the tools of assimilation changed with technology - there was a phase when the government tried to convert the indigenous people into farmers, and they would have nothing of it - but the goal of assimilation was left unmodified, from the 1700s right up to the 1960s. what trudeau aimed to do was go public with it, and make it official policy; he wanted the indigenous groups to understand what was happening and take some control over it, themselves. that was in trudeau's direct democracy phase. as a reaction to the backlash, the liberal government of the time just shut the file down and carried on with the same assimilation policy, quietly, as it always had before. there were blood quantum rules introduced in the 80s, and by the 00s harper was threatening them with property rights (which make no sense in indigenous culture). the idea for decades has been to starve them of funds and create poor conditions to try and convince them to move away from the reserves, while paying lip service to funding increases that never come. but, it doesn't seem to be working - because they don't have the resources to leave.

it doesn't make sense to build cities in the middle of nowhere. so, they should be offered modern housing elsewhere, but not moved - let them freely make the choice to move away.

and, some won't. but, they'll need to get used to living on the edges of civilization, and the lack of comfort inherent within it.

http://www.huffingtonpost.ca/2018/01/19/trudeau-promises-to-help-first-nation-reserve-with-housing-shortage_a_23338560/

jagmeet singh must cut his beard.

Saturday, January 20, 2018

so, what's with russia and turkey, anyways?

well, they've fought wars in the historical period, and not just geographic skirmishes, but deep cultural wars that featured wild card barbarian groups that would take the side of one religion or the other. but, as is so often the case, these deep wars were really actually civil in conflict, as the russians and turks truly represented opposing views in a deep civil war over control of the roman empire, which had long reverted to a greek empire. it's an intra-hellenic conflict.

if you were to map out the areas under the direct control of the actual influence of greek civilization, rather than it's romanized abstraction, it would include both the areas under historical byzantine control and the areas under the control of the orthodox church. broadly speaking, that is the areas in the russian and ottoman empires, with lost colonies along the mediterranean coast, from magna graecia through france and into spain.

historians acknowledge this privately, but seem weird about publishing it: the ottoman empire was really just the reconstruction of the byzantine empire, under a cultural shift to a new religious order, which was maybe even a little more liberal than the previous one, in some ways. there was a population replacement to accompany the shift in religious order, but the empire ultimately survived, albeit under a new ruling class. it should be thought of as a revolution in the empire, then, and not the end of history that the christian byzantines believed that it would be.

it's amazing how that myth - that the fall of constantinople would be the end of history, as jesus would return - has, itself, persisted through the centuries, to continue to colour how we view the events of 1453. this was a revolution, and yet we call it the fall of a civilization - or the beginning of a new one, depending on your perspective. but, the truth seems to rather be continuity in the empire itself - that the hard-headed constantinople, clinging to the past, was finally brought in line with the changes that had already occurred through the rest of the empire. nor did byzantine civilization truly fall, as it was exported to russia, where it carried on; the byzantines lost their empire, but then quickly built a new one.

if there is any process in history, it should lead to these halves of the same civilization re-uniting as the cultural forces that ripped them apart dissipate into history. but, are the societies of turkey and russia ready to move forwards as a new empire - not just politically, but culturally? not for a generation, at least.

the partition of the eastern empire into russian and turkish halves is something that took place over centuries, and is complicated by the absorption and expulsion of a third empire, that of the persians. the initial split happened during the arab expansion, which both led to the toppling of the persian state and to the seizure of much of the eastern mediterranean coast. but, this itself was only possible because the romans were in the process of actually annexing the persians; if accomplished, this would have geographically been a return to the achaemenid empire. it was the persians who were conquering the byzantines from the inside out. the persian empire itself was split by the campaigns of alexander, but continued to exist in a loose federation of hellenic states. this was itself a revolution, from persian to greek cultural norms. - but the empire survived it. the romans presented the next outside and existential threat to the empire, but, by the time of the arab invasions, a thousand years after the romans fought carthage, the empire was finally about to absorb them. what is it to be an empire without an existential threat? but, the arabs were absorbed far more easily than the romans, and it was in truth a new persian empire that spread outwards from the middle east at that time.

the next threat to the persian empire came from the devastating mongol invasions, which left wide swaths of destruction and virtual depopulation in some areas. this was the closest that the persian empire, the cultural continuation of both mesopotamian and greek civilization as well as the inheritor of arab religion, came to actual destruction. institutions throughout the empire ceased to exist, forcing the empire to retreat to the iranian plateau, leaving the majority of the geographic empire in anarchy. the persian empire has truly not recovered from this devastation that happened in the thirteenth century, although it is as close to recovering today as it ever has been.

the turks were the group that eventually re-imposed order in the western part of the persian empire, but they did so by taking control of byzantine institutions and converting them into instruments of their own power. the rise of turkish power should consequently be seen as a counter-revolution of the greco-roman empire against the arab/persian empire, even if it adopted the religion of the latter. and, so, what we see by the end of the sixteenth century is a new greco-roman-turkic empire on the eastern side of europe.

the empire survived, when it's culture did not.

it's culture, meanwhile, fled to moscow - along with aristocrats and clergy. russian expansion began in 1463. eventually, the ruler of russia became the new tsar - that is the new caesar, the new emperor. there were sufficient byzantine bloodlines in the russian ruling class for the western emperor to acknowledge the russian emperor as caesar as early as 1514.

the russians and turks fought their first war from 1568-1570 and their last from 1914-1918, leaving the civil war in a state without resolution, and the southern partition under threat of reabsorption from the western empire, which is on the brink of moving it's capital from london to washington.

i've said this before: if there is any process in history, the eastern emperor will return to constantinople, in time.

jagmeet singh must cut his beard.
i guess i don't like the idea of presenting the situation as a choice between public funding and crowd-sourcing, as i think the better idea is to use them together: crowd-sourcing cannot replace the state in terms of resource allocation, but that doesn't mean it might not be useful to fund certain kinds of research that the government might fear political repercussions around, or might not fund due to corporate capture. for small fundraising purposes, it might be easier to crowdsource than to agitate, but i would dissuade people from disengaging from agitating for further public funds; this can't be a solution to that problem.

in this particular situation, though, i might suggest that a guaranteed annual income might be what would most benefit this researcher, as it would narrow the field of candidates down to the ones that have an engaged interest in the topic. conversely, this is a good example of how i'd imagine a gai would work: people would be freer to participate in their intellectual pursuits, be they in the arts or the sciences or whatever else.

http://www.cbc.ca/news/health/second-opinion-crowdfund-science-research-1.4495632

jagmeet singh must cut his beard.
so, who is this guy, erdogan, anyways?

well, like russia, turkey is in theory subject to periodic elections to change power, although the elections in turkey are somewhat of a joke, due as much to a disproportionate amount of power invested in the rural regions as due to endemic state corruption. like putin, erdogan would have probably won every election he's fought in without cheating, but that doesn't mean they didn't cheat, anyways, just to demonstrate they were in charge. i mean, if you can't rig the election, you're not really in power, right?

so, one way or another, he might not be around too much longer. but, the turkey he's going to leave behind no doubt will be.

now, don't misunderstand my conclusion, here. erdogan is a wily character, no doubt. there was a strange tradition in turkey recently, although i suppose it has it's roots in the iconoclast controversy, where the military would allow elections so long as the outcome remained a secular government, and launch a coup if the government was seen to be carrying forward any kind of islamicization. excuses about the first world war aside, what istanbul really feared was influence from mecca, and then from riyadh - it sought to separate the population from a millennia of history as a muslim province, much of it with illegitimate power as a usurped colonial force from the previous era, and instead assert a concept of turkish nationalism. for, it realized that the combined arab countries that it had colonized for so long were now a direct threat to it, should it conform too heavily to the culture in those states. it had to limit the influence of islam to avoid being absorbed by it.

whether these fears remained valid through the rise of arab socialism is questionable, but the tradition remained in place, nonetheless. upon first taking office, there was every reason to assume that the military would effortlessly remove erdogan should he work towards this goal.

but, erdogan did what no turkish leader had done before him - he reformed the military culture by purging officials thought to be capable or interested in carrying out a coup and replacing them with loyalists. so, when the united states agitated for a coup to replace him, it was unable to do so effectively. that arguably makes him the first fully independent turkish leader since ataturk.

a turkish declaration of independence from nato would have dramatic shifts in the global power balance, simply due to the fact that they would immediately become a regional power. i would not expect the turks to immediately end co-operation with nato, but increased co-operation with russia could neutralize significant strategic advantages that nato has in both the black sea and the baltic regions. and, of course, nato would lose a large, modern, capable standing army, even if it doesn't defect anywhere particular immediately.

so, erdogan was wily enough to change the structure of the state in such a way that he could not be removed in a coup. that's in some ways impressive. and, he seems to have the resources to do sneaky things in the regions directly around his borders to advance his country's own interests. the history is complicated, but, rather than fear russia today, he no doubt believes that turkey could eclipse russia in economic union, and ultimately become the dominant partner in a counter-european axis - an error that is hitleresque in potential scope. wily leaders are in truth best met with checks and balances.

but, while erdogan is wily at home, he is not so wily as putin is when it comes to foreign policy. he does not have the grasp on the games being played, does not have the grasp of tactics or strategy and frankly doesn't have access to the same resources, either in intelligence or in academia.

the empire is right to treat him as a dumb barbarian that can be easily manipulated through hot-headed outbursts of emotion.

jagmeet singh must cut his beard,
in addition to not being invited to bring troops in to syria, america was not invited to the peace talks in astana - and is not invited to help with reconstruction. america will be shut out from those contracts, which will go to russian and chinese firms. the announcement was merely meant to save face, as so many announcements about syria and iran are. the 2015 nuclear deal was about saving face; maybe what i've been saying for years about that is that much more clear, now.

but, why would america do this? is this just daft, as is suggested here?

tillerson doesn't make these choices, of course. he's reading a script (and sounds like it). these decisions come from inside the establishment that trump has chosen not to turn over. it's the same policy people from the obama admin..

turkey is in nato, but nato is losing turkey to russian influence. nato is also losing the kurds. now, it's not like the kurds can actually fight a war against the turks; they can carry out acts of resistance, but there was no kurdistan on the map, last i checked, and it is for that reason: the kurds have no chance against the turks..this would not be a war, but a slaughter.

why is turkey in nato? because it feared soviet expansion. today, turkey fears saudi expansion, and it is russia that is best positioned to counter-balance it. further, turkey has been poorly integrated into the european side of globalization, forcing it to look to asia for partners. there are no serious economic incentives for turkey to remain in nato, right now, and rather strong incentives to decouple. so, if no action is taken, nato is likely to lose turkey to russian influence.

given that truth, it is in america's interest to generate a conflict between russia and turkey. should the turks refuse to return sovereignty to the syrians, that is likely to create a conflict between the russians and turks. if the kurds are enough of a nuisance, the turks might decide they're not leaving. and, are the russians going to scold them for annexing syrian kurdistan? the turks wouldn't annex, they'd occupy, but you get the point.

but, that is indeed the miscalculation. as, such an occupation would actually serve russian interests, in creating a buffer zone of turkish militarization around their own bases, which are the focal point of the conflict.

this is what america does. because it is the empire. but, it's not always the best at it.


jagmeet singh must cut his beard.

Friday, January 19, 2018

i'm going to vote for noise, right now.

the conservatives are running near the high end of their error bar, but it's normal to inflate conservative support a little bit in the numbers - it's a sampling bias and everybody knows it. i've repeatedly presented the number of 30% as a workable zero for conservative support, and it's been hovering near there, now, for years. is 32%, 33% conservative support believable? well, that's still absurdly low, really. but the difference between 34 and 30 on a single poll is negligible, given the importance of that number 30. that's noise. it's going to have to stay put a while to be believable.

the liberals are running around historically normal levels, which is about 40%, maybe just under it. again, 37% is at the bottom of the error bar, but, right now, it's just noise.

...except that something that looks to be a little bit more convincing is a steady uptick in ndp support. the noise in the conservative numbers could be underestimating the distance between the conservatives and the liberals, and presenting a false deduction regarding the lower liberal numbers, which are really bleeding to the ndp.

the other option is that they're bleeding on both sides. but that doesn't seem to be consistent with the data, which is presenting a gap in popularity between the conservative party and it's leader. so, i'm going to vote for noise in the conservative data, for right now - and maybe a signal with the ndp.

http://www.nanosresearch.com/tickers/PDF/20180112%20Political%20Package%20Eng.pdf

jagmeet singh must cut his beard.