so, market surveys are what you do when you want to determine public opinion.
when you want empirical data, on the other hand, you have no choice but to measure it.
as they are giving us a market survey, and not collecting data, they must be requesting an opinion on what we want marijuana to be priced at.
i don't think it should be more expensive than cigarettes. if anything, it should be less expensive to grow.
given current cigarette prices, and the idea that a cigarette is a gram of tobacco, $0.50/gram seems about reasonable - or $10 for 20 grams.
but, are they asking for an opinion? really?
if you're going to do this, use tor or something. and come in as low as you'd like.
https://globalnews.ca/news/3998543/marijuana-pricing-statistics-canada-crowdsourcing-survey/
jagmeet singh must cut his beard.
Wednesday, January 31, 2018
what would an affirmative action actually look like in canada?
if you were to match the population demographics, in canada, not the united states, you'd probably see a net flow of jobs from west and east asian women (no doubt over-represented; very highly educated) to black men and indigenous people (who are the only substantially under-represented groups that i'm aware of).
maybe we'll get a chinese protest.
it really is important to check the country of origin, when you're doing demographic studies.
jagmeet singh must cut his beard.
if you were to match the population demographics, in canada, not the united states, you'd probably see a net flow of jobs from west and east asian women (no doubt over-represented; very highly educated) to black men and indigenous people (who are the only substantially under-represented groups that i'm aware of).
maybe we'll get a chinese protest.
it really is important to check the country of origin, when you're doing demographic studies.
jagmeet singh must cut his beard.
at
18:17
i'm going to make terence's point for him, because he doesn't seem able to make it himself. there's a good possibility that he doesn't understand what he's throwing around, either; the tactic here is merely to cast doubt on the results, not to actually explain why they're being misapplied.
there's three issues, here, not one.
1) equal pay for equal work. that is, increasing the salaries of women that already have jobs so that they match those of their male counterparts, for the same work. i can't think of any way to articulate opposition to this point that isn't chauvinist, so let's assume this is something everybody agrees with, in principle. this would, indeed, produce an instant boost to gdp, by definition, although i'm not going to pull numbers out of my rear. this can and really should be legislated relatively easily, although enforcement might be a bit rough, at least at first.....i think if they pass the law, the culture will adjust, because who honestly disagrees with this? it has potential to be a systemic change in how people, women, are compensated for their labour.
2) making full use of women in the labour market. that is, finding jobs for all the women that don't currently have one. this wouldn't just create an instant boost in gdp, but would even create an instant multiplier, as a good percentage of these women will now require child care of some sort, and perhaps new cars, as well. this number should be higher than the last one. but, this pre-supposes that enough jobs exist for full employment across both genders, and that's basically pre-supposing the growth that the policy would produce. if we could create enough jobs to do this, one wouldn't need a gender policy to enforce, because the market would, indeed, adjust.
3) increasing diversity in the workplace. if we're talking about replacing people, rather than creating new jobs, as we are, then there is really no reason to think this will have any effect on gdp, save for changes in talent, and there's not any reason to think those changes in talent will be positive, if the hiring strategy is purely ethnic.
what terence wants to say here, but can't put together, is that trudeau is kind of merging these ideas together, and mixing them up in a sort of confusing way that is designed more as a pr strategy than a policy proposal. he's presenting (1) and (3) as ways to achieve (2), and then arguing that investing in women, by itself, will increase gdp. maybe trudeau is, himself, legitimately dazed by the numbers, but i doubt the party is.
so, is a policy of increasing diversity going to increase gdp? well that's not what the studies say. what the studies say is that,
1) if you increase salaries for 40% of the workforce, or whatever it is nowadays, then gdp will go up. this is tautological.
2) if enough jobs were created so that women increase their participation levels to that of men, then gdp would increase by x amount. again: i'm not weighing in on the value of x. but, a substantial increase, here, is tautological: more jobs means more demand exists which means higher gdp. that does not require further study, that's a definition. and, that definition unquestionably implies diminishing returns, as the participation numbers balance out. what requires further study is epsilon, where x +/- e is the corrected range for the gdp numbers.
what do i think?
well, the tautologies are what they are. and, as mentioned, equal pay for equal work is really not controversial, is it? but, the rest of it is muddled up.
no diversity policy will create jobs. you need to find ways to increase aggregate demand, for that.
so, the end goals will mostly not follow from the proposed policy.
but, as is often the case with these wonky policies that the liberals have brought in under this government, i don't find myself all that opposed. i don't know if they plan on inserting quotas, or what. my take on affirmative action is that it was something that was worth a try, but that it always ought to have been temporary, until the workforce balances out a little. it should have come with a kind of sunset clause that was meant to evaluate the success of the program. by any metric, affirmative action has not succeeded in it's stated intent. at this point, i don't see any point in repeating failed approaches. i'd like to try something else.
but, i have to ask the question: how necessary is this, really? and, i'm not convinced it's nearly as necessary as some would claim. i want to look at things like trendlines. are companies becoming more diverse, as the country goes through changes? are more second generation immigrants getting hired? my understanding is that second generation canadians are really the most successful segment of society at this point, and that they're doing just fine in outcompeting everybody else - although some of them may still be dragging around cultural attitudes about women that white canadians largely dropped in the last generation, or the one before it.
i mean, if you want to talk about intersectionality, ask yourself this question: would businesses that have strong influences by men reared in other cultures be more likely or maybe less likely to hire minority women?
so, not only are we getting a false solution to an actual problem, but the more important data required to get to a real solution isn't being analysed at all.
but, terence at least knows that trudeau's feminist strategy is about politics, and not about policy. so, maybe i'm the one who missed the point, after all.
http://business.financialpost.com/opinion/terence-corcoran-the-dodgy-studies-behind-trudeaus-radical-experiment-to-socially-engineer-canadian-businesses
jagmeet singh must cut his beard.
there's three issues, here, not one.
1) equal pay for equal work. that is, increasing the salaries of women that already have jobs so that they match those of their male counterparts, for the same work. i can't think of any way to articulate opposition to this point that isn't chauvinist, so let's assume this is something everybody agrees with, in principle. this would, indeed, produce an instant boost to gdp, by definition, although i'm not going to pull numbers out of my rear. this can and really should be legislated relatively easily, although enforcement might be a bit rough, at least at first.....i think if they pass the law, the culture will adjust, because who honestly disagrees with this? it has potential to be a systemic change in how people, women, are compensated for their labour.
2) making full use of women in the labour market. that is, finding jobs for all the women that don't currently have one. this wouldn't just create an instant boost in gdp, but would even create an instant multiplier, as a good percentage of these women will now require child care of some sort, and perhaps new cars, as well. this number should be higher than the last one. but, this pre-supposes that enough jobs exist for full employment across both genders, and that's basically pre-supposing the growth that the policy would produce. if we could create enough jobs to do this, one wouldn't need a gender policy to enforce, because the market would, indeed, adjust.
3) increasing diversity in the workplace. if we're talking about replacing people, rather than creating new jobs, as we are, then there is really no reason to think this will have any effect on gdp, save for changes in talent, and there's not any reason to think those changes in talent will be positive, if the hiring strategy is purely ethnic.
what terence wants to say here, but can't put together, is that trudeau is kind of merging these ideas together, and mixing them up in a sort of confusing way that is designed more as a pr strategy than a policy proposal. he's presenting (1) and (3) as ways to achieve (2), and then arguing that investing in women, by itself, will increase gdp. maybe trudeau is, himself, legitimately dazed by the numbers, but i doubt the party is.
so, is a policy of increasing diversity going to increase gdp? well that's not what the studies say. what the studies say is that,
1) if you increase salaries for 40% of the workforce, or whatever it is nowadays, then gdp will go up. this is tautological.
2) if enough jobs were created so that women increase their participation levels to that of men, then gdp would increase by x amount. again: i'm not weighing in on the value of x. but, a substantial increase, here, is tautological: more jobs means more demand exists which means higher gdp. that does not require further study, that's a definition. and, that definition unquestionably implies diminishing returns, as the participation numbers balance out. what requires further study is epsilon, where x +/- e is the corrected range for the gdp numbers.
what do i think?
well, the tautologies are what they are. and, as mentioned, equal pay for equal work is really not controversial, is it? but, the rest of it is muddled up.
no diversity policy will create jobs. you need to find ways to increase aggregate demand, for that.
so, the end goals will mostly not follow from the proposed policy.
but, as is often the case with these wonky policies that the liberals have brought in under this government, i don't find myself all that opposed. i don't know if they plan on inserting quotas, or what. my take on affirmative action is that it was something that was worth a try, but that it always ought to have been temporary, until the workforce balances out a little. it should have come with a kind of sunset clause that was meant to evaluate the success of the program. by any metric, affirmative action has not succeeded in it's stated intent. at this point, i don't see any point in repeating failed approaches. i'd like to try something else.
but, i have to ask the question: how necessary is this, really? and, i'm not convinced it's nearly as necessary as some would claim. i want to look at things like trendlines. are companies becoming more diverse, as the country goes through changes? are more second generation immigrants getting hired? my understanding is that second generation canadians are really the most successful segment of society at this point, and that they're doing just fine in outcompeting everybody else - although some of them may still be dragging around cultural attitudes about women that white canadians largely dropped in the last generation, or the one before it.
i mean, if you want to talk about intersectionality, ask yourself this question: would businesses that have strong influences by men reared in other cultures be more likely or maybe less likely to hire minority women?
so, not only are we getting a false solution to an actual problem, but the more important data required to get to a real solution isn't being analysed at all.
but, terence at least knows that trudeau's feminist strategy is about politics, and not about policy. so, maybe i'm the one who missed the point, after all.
http://business.financialpost.com/opinion/terence-corcoran-the-dodgy-studies-behind-trudeaus-radical-experiment-to-socially-engineer-canadian-businesses
jagmeet singh must cut his beard.
at
17:13
i have never had a cavity, btw.
if you're curious.
if you've guessed my age.
jagmeet singh must cut his beard.
if you're curious.
if you've guessed my age.
jagmeet singh must cut his beard.
at
08:37
and, to the liberal party, let me ask you directly:
is the legacy of american slavery really something you want to volunteer to absorb? what exactly are you in solidarity with? and, have you really thought through the ramifications of this?
jagmeet singh must cut his beard.
is the legacy of american slavery really something you want to volunteer to absorb? what exactly are you in solidarity with? and, have you really thought through the ramifications of this?
jagmeet singh must cut his beard.
at
05:09
imagine how angry this would make you.
suppose you're a student in, let's say ghana. your parents tell you that the only way out of this shithole is through a scholarship, so you study as hard as you can, and manage to get a scholarship to go to university to study engineering in canada.
you're perhaps not expecting utopia, but you're there after being flown across the world because you were identified as an elite student.
so, imagine what it feels like, when you get there, to be told you're supposed to identify with the (formerly) enslaved class in the country next door, despite canada having no meaningful history of slavery, due solely to the colour of your skin. your told you should be happy you're not a slave. that would be as strong a punch to the gut as you could imagine.
let's be a little more explicit, because black history month is really anything but. black history month should be explicitly called african-american history month, because it deals with themes that are inherent to being american, rather than themes that are inherent to being black.
as mentioned, in canada, a black history month would simply not be very substantial. but, in a few generations time, black canadians will have a very different history to present, won't they?
jagmeet singh must cut his beard.
suppose you're a student in, let's say ghana. your parents tell you that the only way out of this shithole is through a scholarship, so you study as hard as you can, and manage to get a scholarship to go to university to study engineering in canada.
you're perhaps not expecting utopia, but you're there after being flown across the world because you were identified as an elite student.
so, imagine what it feels like, when you get there, to be told you're supposed to identify with the (formerly) enslaved class in the country next door, despite canada having no meaningful history of slavery, due solely to the colour of your skin. your told you should be happy you're not a slave. that would be as strong a punch to the gut as you could imagine.
let's be a little more explicit, because black history month is really anything but. black history month should be explicitly called african-american history month, because it deals with themes that are inherent to being american, rather than themes that are inherent to being black.
as mentioned, in canada, a black history month would simply not be very substantial. but, in a few generations time, black canadians will have a very different history to present, won't they?
jagmeet singh must cut his beard.
at
05:05
and, i should point out the following as well....
the vast majority of black canadians - i mean like 99% - would actually reject the idea that they have any cultural connection to american history, and thereby reject black history month along with it. that is actually kind of a big deal in canada, rather than black history month, itself. because, the best way to piss off a black canadian is to suggest their ancestors were slaves.
because it's usually not true. and, they want you to know it's not true, so you don't think it is. it's not just an ego thing; black canadians overwhelming expect that you won't treat them as the descendant of slaves. because they aren't. and they'll put you in your place if you suggest that they are.
it follows that trudeau is diving head first into instant death if he thinks that pushing black history month is a way to win votes from black voters. not only is the african american narrative not something that black canadians identify with, it's something that they vehemently reject. it's an insult to them.
trudeau is going to get his teflon suit full of eggs if he thinks he's going to talk about this kind of thing with black canadians and get anything more than a guffaw.
"excuse me. sir, are you implying that my ancestors, and the ancestors of the other people in this room, were slaves? because, if you are, i'm appalled."
and, see, a canadian pr team would know that, too. but, when you go and hire all these american strategists (that may have been born in canada, but are culturally american), they miss things like this.
and, that's the irony, right?
"african-americans, black canadians....they're all the same, right?"
no.
one group descends from chattel slavery and has roots in the united states since the fifteenth century. the other is highly educated, mostly middle-classed and has arrived in canada almost entirely since 1970, either from the caribbean or directly from africa, and largely via scholarship grants.
and, the implication that there is any commonality at all is, in fact, brutally racist, which is what trudeau will be told, when it comes to it.
jagmeet singh must cut his beard.
the vast majority of black canadians - i mean like 99% - would actually reject the idea that they have any cultural connection to american history, and thereby reject black history month along with it. that is actually kind of a big deal in canada, rather than black history month, itself. because, the best way to piss off a black canadian is to suggest their ancestors were slaves.
because it's usually not true. and, they want you to know it's not true, so you don't think it is. it's not just an ego thing; black canadians overwhelming expect that you won't treat them as the descendant of slaves. because they aren't. and they'll put you in your place if you suggest that they are.
it follows that trudeau is diving head first into instant death if he thinks that pushing black history month is a way to win votes from black voters. not only is the african american narrative not something that black canadians identify with, it's something that they vehemently reject. it's an insult to them.
trudeau is going to get his teflon suit full of eggs if he thinks he's going to talk about this kind of thing with black canadians and get anything more than a guffaw.
"excuse me. sir, are you implying that my ancestors, and the ancestors of the other people in this room, were slaves? because, if you are, i'm appalled."
and, see, a canadian pr team would know that, too. but, when you go and hire all these american strategists (that may have been born in canada, but are culturally american), they miss things like this.
and, that's the irony, right?
"african-americans, black canadians....they're all the same, right?"
no.
one group descends from chattel slavery and has roots in the united states since the fifteenth century. the other is highly educated, mostly middle-classed and has arrived in canada almost entirely since 1970, either from the caribbean or directly from africa, and largely via scholarship grants.
and, the implication that there is any commonality at all is, in fact, brutally racist, which is what trudeau will be told, when it comes to it.
jagmeet singh must cut his beard.
at
04:13
i think the only state of the union address i've ever watched was the one in 2002.
i'm not an american. it doesn't mean much to me. and, i don't want to watch your president lie for an hour.
to be clear: they all lie spend the hour lying through their teeth. take a random clinton state of the union and fact check it and see if it's much better than trump's; it won't be. and, what's the point of watching that?
jagmeet singh must cut his beard.
i'm not an american. it doesn't mean much to me. and, i don't want to watch your president lie for an hour.
to be clear: they all lie spend the hour lying through their teeth. take a random clinton state of the union and fact check it and see if it's much better than trump's; it won't be. and, what's the point of watching that?
jagmeet singh must cut his beard.
at
02:59
nonononononono
ok.
imagine this: imagine the president of the united states taking the stage, and announcing that the american government will recognize a national holiday around the struggle of french canadians, because it recognizes the importance of quebecois history and the contributions that quebeckers have made to american society.
that makes about as much sense to americans as celebrating black history month makes to canadians. if you are the fraction of a percent of canadians that is descended from american slaves, nobody is stopping you from celebrating your history. nobody is stopping quebecois-americans from celebrating their history in america, either. but, few people would argue that the contributions of quebec to american society are worth taking much special note of, or that the influence of french canada (while demographically substantial) is of much importance to american culture.
if the president were to do such a thing in the same week as an investigation was being launched into a conflict of interest, one might conclude that it's just some frivolous bullshit to distract the media with, and an attempt to avoid taking serious questions. and, one might applaud the journalists that see through it and ask tough questions, when the event is designed to take softballs.
now, trump will tweet out america's new adoption of international de gaulle day.
jagmeet singh must cut his beard.
ok.
imagine this: imagine the president of the united states taking the stage, and announcing that the american government will recognize a national holiday around the struggle of french canadians, because it recognizes the importance of quebecois history and the contributions that quebeckers have made to american society.
that makes about as much sense to americans as celebrating black history month makes to canadians. if you are the fraction of a percent of canadians that is descended from american slaves, nobody is stopping you from celebrating your history. nobody is stopping quebecois-americans from celebrating their history in america, either. but, few people would argue that the contributions of quebec to american society are worth taking much special note of, or that the influence of french canada (while demographically substantial) is of much importance to american culture.
if the president were to do such a thing in the same week as an investigation was being launched into a conflict of interest, one might conclude that it's just some frivolous bullshit to distract the media with, and an attempt to avoid taking serious questions. and, one might applaud the journalists that see through it and ask tough questions, when the event is designed to take softballs.
now, trump will tweet out america's new adoption of international de gaulle day.
jagmeet singh must cut his beard.
at
02:51
“What the journalists did was hijack the conversation and deterred it from being on topic,”
no.
what happened was that the government held a press conference about an american political issue to try and distract from issues that actually matter in canada, and the press corps called them on it and turned the topic back to things that are actually interesting to canadians.
it's the government, here, that's guilty of creating distractions by pulling out the identity card, on an issue that canadians correctly don't recognize as relevant to them, because the facts are that it isn't. and, there's no use in feigning naivete, either. this was an intentional distraction. and, it's the media that turned the topic back to something canadians want to talk about.
jagmeet singh must cut his beard.
no.
what happened was that the government held a press conference about an american political issue to try and distract from issues that actually matter in canada, and the press corps called them on it and turned the topic back to things that are actually interesting to canadians.
it's the government, here, that's guilty of creating distractions by pulling out the identity card, on an issue that canadians correctly don't recognize as relevant to them, because the facts are that it isn't. and, there's no use in feigning naivete, either. this was an intentional distraction. and, it's the media that turned the topic back to something canadians want to talk about.
jagmeet singh must cut his beard.
at
02:41
these are just numbers:
number of black people in new york city ~ 2 200 000 (30%)
number of black people in canada ~ 1 200 000 (3%)
number of black people in chicago ~ 900 0000 (30%)
number of indigenous people in canada ~ 1 400 000 (4%)
detroit is 80% black.
los angeles is 40% black.
montreal and toronto are both 9% black. [note that many african countries have french speakers, and that almost none of these people are descendants of slaves]
vancouver is about 1% black, which is more representative of most of the country.
toronto is 20% east asian [chinese, korean, japanese, philipino]
toronto is 13% south asian [indian]
toronto is 9% black.
toronto is 4% west asian [arab, persian, turk]
toronto is 3% latino
jagmeet singh must cut his beard.
number of black people in new york city ~ 2 200 000 (30%)
number of black people in canada ~ 1 200 000 (3%)
number of black people in chicago ~ 900 0000 (30%)
number of indigenous people in canada ~ 1 400 000 (4%)
detroit is 80% black.
los angeles is 40% black.
montreal and toronto are both 9% black. [note that many african countries have french speakers, and that almost none of these people are descendants of slaves]
vancouver is about 1% black, which is more representative of most of the country.
toronto is 20% east asian [chinese, korean, japanese, philipino]
toronto is 13% south asian [indian]
toronto is 9% black.
toronto is 4% west asian [arab, persian, turk]
toronto is 3% latino
jagmeet singh must cut his beard.
at
01:57
that's right: the plight of black canadians is not "top of mind" in canada because, unless you live in a handful of districts in toronto, they really don't exist. black canadians are less than 3% of the population, in canada, and almost all of them have arrived since 1970. they were barely present at all in the early years of the country, as slaves or as citizens, and did not stay after the underground railroad, for whatever reasons. there are only a handful of black communities in canada, and most of them are not urban but actually quite remote. that's very different than the united states, where blacks are about 10% nationally and make up majorities in substantial parts of the country, including in major urban areas.
in the united states, blacks are without a doubt the largest minority group and of exceeding importance in the country. in canada, they're like 15th - sandwiched between japanese and jewish, or something.
the largest and most important minority groups in canada are not black africans, but lighter-skinned indigenous people and asians, both east and south. we will have chinese and indian prime ministers before we have african ones, and we may never have african ones at all.
the trudeau government's strange focus on african-canadians is an imported americanism, a consequence of the fact that so much of the liberal party went to school in the united states. and, that's a problem that the party needs to come to grips with: it needs more canadians in it's top positions. it's not running for office in california.
the media was right to change the topic, and the party should get the point.
http://www.huffingtonpost.ca/2018/01/30/justin-trudeau-gets-no-questions-about-black-canadians-at-press-conference-focused-on-their-experiences_a_23348080/
jagmeet singh must cut his beard.
in the united states, blacks are without a doubt the largest minority group and of exceeding importance in the country. in canada, they're like 15th - sandwiched between japanese and jewish, or something.
the largest and most important minority groups in canada are not black africans, but lighter-skinned indigenous people and asians, both east and south. we will have chinese and indian prime ministers before we have african ones, and we may never have african ones at all.
the trudeau government's strange focus on african-canadians is an imported americanism, a consequence of the fact that so much of the liberal party went to school in the united states. and, that's a problem that the party needs to come to grips with: it needs more canadians in it's top positions. it's not running for office in california.
the media was right to change the topic, and the party should get the point.
http://www.huffingtonpost.ca/2018/01/30/justin-trudeau-gets-no-questions-about-black-canadians-at-press-conference-focused-on-their-experiences_a_23348080/
jagmeet singh must cut his beard.
at
01:10
Tuesday, January 30, 2018
if you think that it's dark or scary to imagine we have no purpose - as though this is an obscure possibility, right - then you are experiencing something called existential dread.
i would argue that it is really existential dread that is at the root cause of the continuing spread of religion, well into an era where it should have ceased to exist many decades ago.
jagmeet singh must cut his beard.
i would argue that it is really existential dread that is at the root cause of the continuing spread of religion, well into an era where it should have ceased to exist many decades ago.
jagmeet singh must cut his beard.
at
22:59
"but, science says the purpose of existence is to maximize your
number of descendants, so shouldn't being an atheist mean you want to
have as many kids as you can?"
it's funny how religious people tend to think that science perfectly upholds religion, isn't it? i mean, how could it not, if you're absolutely certain in your faith? that's the thing about faith - all possible evidence always upholds it. if you have faith in santa claus, the absence of presents under the tree any given year just proves you were bad. and, if you have faith in god, then any possible set of events that can be thrown at you will just be perverted to offer more and more evidence for it's existence.
faith is a perversion of logic. that is why it is such a dangerous tool, and must be kept away from the state.
in the western/judaic context, this talk of descendant maximization goes all the way back to the torah. god gave abraham this purpose. but, how did this get attached to science? well, it didn't, except in the minds of religious people, that are seeking out some kind of purpose, because that was what they were taught to seek out.
so, we have this problem: when people raised with religious upbringings come into contact with science, they need to frame it in terms that they understand. religion teaches them that existence is about purpose, and that that purpose has something to do with god (although this itself is circular logic, as the purpose is created to justify god, rather than the other way around). if science is to offer some alternative to religion, it must offer some alternate purpose, right? and, from there, they come up with this vulgar dawkinsianism that deduces that our purpose, as humans, is in carrying on the dna. we exist to breed.
but, the reality is that you'd be hard-pressed to find a scientist (or an atheist) of any ability or renown that would accept that humans have any kind of purpose, as that pre-supposes that a god exists to define it, first. who or what defines purpose, if god does not exist? it's a neat trick that the religious person does, here, in defining existence in purely religious terms, before bringing it to the scientific bodies for answers, as, once you have done that, you have hard-wired religion into the question, and made it useless to science. you can walk down this path with philosophy, it's what it's all about, but not with science, which will provide you with no worthwhile answers if you present it with what are brutally leading questions.
science cannot pre-suppose that a purpose exists. science must gather evidence to determine if it suggests that a purpose exists. whether the nature of the purpose is an empirical question or not, which is what the religionists pre-suppose and assign to scientists as a strawman, is reliant on whether the purpose exists or not, first, which is also an empirical question, and not something to pre-suppose at all.
while it would be extremely difficult to do a comprehensive study that empirically disproves that we have purposes, the lack of evidence underlying any purpose is a convincing argument that we have no purposes, for most atheists and most scientists.
and, so this is what the atheist will tell you: science does not argue that our purpose is to breed, but rather that we have no inherent purpose at all, and are free to define our purposes as we see fit to do so.
i've decided that my purpose is not to raise a family but to to complete my discography, and, because i seek to be free, there is nothing in the universe that has the right to challenge my authority on the point.
jagmeet singh must cut his beard.
it's funny how religious people tend to think that science perfectly upholds religion, isn't it? i mean, how could it not, if you're absolutely certain in your faith? that's the thing about faith - all possible evidence always upholds it. if you have faith in santa claus, the absence of presents under the tree any given year just proves you were bad. and, if you have faith in god, then any possible set of events that can be thrown at you will just be perverted to offer more and more evidence for it's existence.
faith is a perversion of logic. that is why it is such a dangerous tool, and must be kept away from the state.
in the western/judaic context, this talk of descendant maximization goes all the way back to the torah. god gave abraham this purpose. but, how did this get attached to science? well, it didn't, except in the minds of religious people, that are seeking out some kind of purpose, because that was what they were taught to seek out.
so, we have this problem: when people raised with religious upbringings come into contact with science, they need to frame it in terms that they understand. religion teaches them that existence is about purpose, and that that purpose has something to do with god (although this itself is circular logic, as the purpose is created to justify god, rather than the other way around). if science is to offer some alternative to religion, it must offer some alternate purpose, right? and, from there, they come up with this vulgar dawkinsianism that deduces that our purpose, as humans, is in carrying on the dna. we exist to breed.
but, the reality is that you'd be hard-pressed to find a scientist (or an atheist) of any ability or renown that would accept that humans have any kind of purpose, as that pre-supposes that a god exists to define it, first. who or what defines purpose, if god does not exist? it's a neat trick that the religious person does, here, in defining existence in purely religious terms, before bringing it to the scientific bodies for answers, as, once you have done that, you have hard-wired religion into the question, and made it useless to science. you can walk down this path with philosophy, it's what it's all about, but not with science, which will provide you with no worthwhile answers if you present it with what are brutally leading questions.
science cannot pre-suppose that a purpose exists. science must gather evidence to determine if it suggests that a purpose exists. whether the nature of the purpose is an empirical question or not, which is what the religionists pre-suppose and assign to scientists as a strawman, is reliant on whether the purpose exists or not, first, which is also an empirical question, and not something to pre-suppose at all.
while it would be extremely difficult to do a comprehensive study that empirically disproves that we have purposes, the lack of evidence underlying any purpose is a convincing argument that we have no purposes, for most atheists and most scientists.
and, so this is what the atheist will tell you: science does not argue that our purpose is to breed, but rather that we have no inherent purpose at all, and are free to define our purposes as we see fit to do so.
i've decided that my purpose is not to raise a family but to to complete my discography, and, because i seek to be free, there is nothing in the universe that has the right to challenge my authority on the point.
jagmeet singh must cut his beard.
at
22:44
Monday, January 29, 2018
see, this is the game that the ndp get to play, so long as you don't release the text - they can feign agnosticism to the text, thereby stringing along opponents long enough that they fail to organize, until they get a chance to see it.
by explicitly citing intellectual property rights protections, which appear to have been relaxed with the withdrawal of the united states, they appear to be setting up a situation where they can accept the changes.
that said, they are getting to the heart of the problem of the deal. as i've mentioned, the tpp was always meant to reconstruct the wartime japanese empire, including ambitions in australia and india, but this time as an economic block, under american hegemony, with the explicit purpose of containing china. what the american withdrawal really does is it lets loose this neo japanese empire to act outside of direct american hegemony, and that may mean co-operation, rather than competition, with the chinese, and the russians. it was a total fuck up, from an american-centric geostrategic perspective.
but, what that means is that the islands in the southeast of asia are going to be largely reconverted into japanese colonial holdings, that they will supply resources and labour to the multinationals that are headquartered in japan to service the japanese market and markets that japan exports to, including china and north america.
japan does still make a lot of electronics, but it doesn't make them in north america. the thing it makes in north america is cars. so, these new rules to reduce the cost of production in asia will tempt the japanese to move production of parts to asia, and then import them to canada, rather than make them here. in a worst case scenario, the north american operations could be reduced to something like an ikea process to building automobiles.
the trade-off is a larger export market for agricultural goods. that doesn't help people where i live much. but, if you're looking at aggregate national numbers, it might add up to a net positive for the country. and, that's the problem that workers here have really faced for decades - small concessions to industry taken one at a time always balance out to other factors, and then add up over a long time.
so, how do you fix this?
well, the ideal solution is to support workers movements in asia. the agreement is supposed to insist on labour regulations, but they already sold us that bridge at nafta - don't believe that. it's not enforceable. workers always need to win their own rights. the establishment of a sustainable wage standard across the trading block would localize production for local markets, as the transportation costs would become superfluous. that's what everybody, save the vultures, really want in the end; it's the endpoint of all of the ideologies. and, it's attainable. to get to this point, it's imperative that workers see each other as united in co-operation, rather than divided in competition. for, if they compete, they produce a race to the bottom. the focus should be on lifting them up.
but, for this particular deal, i'm not convinced it's the way forward for anybody. the agriculture industry would be far better off in a bilateral deal with japan that keeps canada outside of this neo japanese colonial sphere. and, i might agitate for that approach, instead.
but, i expect the ndp to support the deal, based on this posturing.
https://www.ctvnews.ca/politics/ndp-trade-critic-calls-on-trudeau-to-release-all-details-of-new-tpp-deal-1.3780081
jagmeet singh must cut his beard.
by explicitly citing intellectual property rights protections, which appear to have been relaxed with the withdrawal of the united states, they appear to be setting up a situation where they can accept the changes.
that said, they are getting to the heart of the problem of the deal. as i've mentioned, the tpp was always meant to reconstruct the wartime japanese empire, including ambitions in australia and india, but this time as an economic block, under american hegemony, with the explicit purpose of containing china. what the american withdrawal really does is it lets loose this neo japanese empire to act outside of direct american hegemony, and that may mean co-operation, rather than competition, with the chinese, and the russians. it was a total fuck up, from an american-centric geostrategic perspective.
but, what that means is that the islands in the southeast of asia are going to be largely reconverted into japanese colonial holdings, that they will supply resources and labour to the multinationals that are headquartered in japan to service the japanese market and markets that japan exports to, including china and north america.
japan does still make a lot of electronics, but it doesn't make them in north america. the thing it makes in north america is cars. so, these new rules to reduce the cost of production in asia will tempt the japanese to move production of parts to asia, and then import them to canada, rather than make them here. in a worst case scenario, the north american operations could be reduced to something like an ikea process to building automobiles.
the trade-off is a larger export market for agricultural goods. that doesn't help people where i live much. but, if you're looking at aggregate national numbers, it might add up to a net positive for the country. and, that's the problem that workers here have really faced for decades - small concessions to industry taken one at a time always balance out to other factors, and then add up over a long time.
so, how do you fix this?
well, the ideal solution is to support workers movements in asia. the agreement is supposed to insist on labour regulations, but they already sold us that bridge at nafta - don't believe that. it's not enforceable. workers always need to win their own rights. the establishment of a sustainable wage standard across the trading block would localize production for local markets, as the transportation costs would become superfluous. that's what everybody, save the vultures, really want in the end; it's the endpoint of all of the ideologies. and, it's attainable. to get to this point, it's imperative that workers see each other as united in co-operation, rather than divided in competition. for, if they compete, they produce a race to the bottom. the focus should be on lifting them up.
but, for this particular deal, i'm not convinced it's the way forward for anybody. the agriculture industry would be far better off in a bilateral deal with japan that keeps canada outside of this neo japanese colonial sphere. and, i might agitate for that approach, instead.
but, i expect the ndp to support the deal, based on this posturing.
https://www.ctvnews.ca/politics/ndp-trade-critic-calls-on-trudeau-to-release-all-details-of-new-tpp-deal-1.3780081
jagmeet singh must cut his beard.
at
19:56
so, how important were the iranians - the alans - in building what we call france, anyways?
well, we know there were substantial migrations of iranians into france, as there were substantial migrations of celts back into the plateaus. there was a two-way flow there, for a long time.
we also know that there was enough of a settled iranian presence in the areas around belgium and northern france, the origin area of the franks, that shrines were built to iranian deities, although there is a curious tendency in the literature to attribute this to trade contacts and a mass fetish for 'orientalism', despite the known migration histories. i put these two facts together and deduce that there were established iranian settlements in this region, just before the franks appear kind of out of nowhere.
the franks weren't really an ethnic confederacy. it was a german word, but it meant the free tribes of varying sorts in that particular region at the corner of the empire: celts, germans and enough iranians to take note of. but, the iranians tend to be ignored due to the fact that they did, indeed, assimilate to the new germanicized roman order, whereas the celts kind of held out.
there's a specific area of the map in france where everything is all about alan. everything ends up named alain in some abstraction, from mountains to cities to rivers to people. alain is probably recognizable to most as a french name, but it is actually iranian in origin, and a memory of the iranian tribe of alans that settled that area, before they vanished to history.
the idea i want to put forward is that they were probably important enough in the development of the frankish federation that they contributed to the cimmerian origin myth, which said that the franks came from the area around scythia, after a fancy detour through both trojan and roman lore. but, these were invented histories, invented purposefully to control the population with. the alans at least came from scythia, though. they appear to have been important enough to be necessary to include in the composite. and, due to the composite, we can indeed remember their importance in the federation.
jagmeet singh must cut his beard.
well, we know there were substantial migrations of iranians into france, as there were substantial migrations of celts back into the plateaus. there was a two-way flow there, for a long time.
we also know that there was enough of a settled iranian presence in the areas around belgium and northern france, the origin area of the franks, that shrines were built to iranian deities, although there is a curious tendency in the literature to attribute this to trade contacts and a mass fetish for 'orientalism', despite the known migration histories. i put these two facts together and deduce that there were established iranian settlements in this region, just before the franks appear kind of out of nowhere.
the franks weren't really an ethnic confederacy. it was a german word, but it meant the free tribes of varying sorts in that particular region at the corner of the empire: celts, germans and enough iranians to take note of. but, the iranians tend to be ignored due to the fact that they did, indeed, assimilate to the new germanicized roman order, whereas the celts kind of held out.
there's a specific area of the map in france where everything is all about alan. everything ends up named alain in some abstraction, from mountains to cities to rivers to people. alain is probably recognizable to most as a french name, but it is actually iranian in origin, and a memory of the iranian tribe of alans that settled that area, before they vanished to history.
the idea i want to put forward is that they were probably important enough in the development of the frankish federation that they contributed to the cimmerian origin myth, which said that the franks came from the area around scythia, after a fancy detour through both trojan and roman lore. but, these were invented histories, invented purposefully to control the population with. the alans at least came from scythia, though. they appear to have been important enough to be necessary to include in the composite. and, due to the composite, we can indeed remember their importance in the federation.
jagmeet singh must cut his beard.
at
06:38
our mining companies are out of control.
so, this is much called for, as a preliminary step. i've argued in the past that we should be using the rome convention to prosecute human rights abuses...and there are stories of villages being burned down, mass rape, just horrific behaviour....
as this is tied into the country's image, and the prime minister is greatly concerned about this, it's difficult to tell if this is serious or not. you'd assume it isn't, a priori, but it's actually in a priority zone for the pmo. at least the government is recognizing that there is a serious problem with how canadian mining businesses, especially, are conducting themselves overseas.
http://www.cbc.ca/news/politics/corporate-ombudsman-abroad-1.4491388
jagmeet singh must cut his beard.
so, this is much called for, as a preliminary step. i've argued in the past that we should be using the rome convention to prosecute human rights abuses...and there are stories of villages being burned down, mass rape, just horrific behaviour....
as this is tied into the country's image, and the prime minister is greatly concerned about this, it's difficult to tell if this is serious or not. you'd assume it isn't, a priori, but it's actually in a priority zone for the pmo. at least the government is recognizing that there is a serious problem with how canadian mining businesses, especially, are conducting themselves overseas.
http://www.cbc.ca/news/politics/corporate-ombudsman-abroad-1.4491388
jagmeet singh must cut his beard.
at
01:36
i'm sorry, i just think that the proper political entity to fight brexit is the liberal party, and not the labour party. and, i actually want to see them do it; this would be the correct unfolding of a process in history.
really, the british liberals are missing in action, right now. and, it's an affront to history. it's not too late.
jagmeet singh must cut his beard.
really, the british liberals are missing in action, right now. and, it's an affront to history. it's not too late.
jagmeet singh must cut his beard.
at
00:43
that commercial for the liberals in the uk should be created as a dramatic personal reflection. just somebody talking to themselves...
"i'm a liberal.
(rising orchestral music slowly fades in).
wait. i just got it. i'm....i'm a liberal.
a liberal.
(rising music coming to climax)
I'M A LIBERAL.
(crashes of whatever type, maybe backwards guitars and distorted cellos, with a deep gong and some electronic noise filling out the spectrum.)
so, i should vote Liberal.
(music fades...)
'cause i'm a liberal.
(music stops)
get it?"
jagmeet singh must cut his beard.
"i'm a liberal.
(rising orchestral music slowly fades in).
wait. i just got it. i'm....i'm a liberal.
a liberal.
(rising music coming to climax)
I'M A LIBERAL.
(crashes of whatever type, maybe backwards guitars and distorted cellos, with a deep gong and some electronic noise filling out the spectrum.)
so, i should vote Liberal.
(music fades...)
'cause i'm a liberal.
(music stops)
get it?"
jagmeet singh must cut his beard.
at
00:39
Sunday, January 28, 2018
it's not a question of if the chinese have operatives in canada, but a question of how many chinese operatives exist in canada.
the chinese appear to be rather unhappy with us, at the moment.
this is just such absolutely convoluted thinking that it's almost impossible to believe that hundreds of people around the country all think that the prime minister has anything to do with the girl's description of her attacker.
and, if i understand correctly, they seem to want the prime minister to walk back a statement of solidarity with a child that claimed she was randomly attacked. what planet does the chinese intelligence live on where this is a remotely acceptable thing to even think?
maybe i'm missing some cultural chinese thing, or something. but most canaduans aren't even going to understand what these people are protesting, and you can't agree or disagree with something if you can't even make sense of it.
i have no idea why the news covered this.
http://www.cbc.ca/news/canada/saskatchewan/protest-regina-victoria-park-asian-community-hijab-cutting-1.4508019
jagmeet singh must cut his beard.
the chinese appear to be rather unhappy with us, at the moment.
this is just such absolutely convoluted thinking that it's almost impossible to believe that hundreds of people around the country all think that the prime minister has anything to do with the girl's description of her attacker.
and, if i understand correctly, they seem to want the prime minister to walk back a statement of solidarity with a child that claimed she was randomly attacked. what planet does the chinese intelligence live on where this is a remotely acceptable thing to even think?
maybe i'm missing some cultural chinese thing, or something. but most canaduans aren't even going to understand what these people are protesting, and you can't agree or disagree with something if you can't even make sense of it.
i have no idea why the news covered this.
http://www.cbc.ca/news/canada/saskatchewan/protest-regina-victoria-park-asian-community-hijab-cutting-1.4508019
jagmeet singh must cut his beard.
at
23:48
well, elizabeth, they may forgive you for the times that you expressed yourself clearly, but they might not forgive you for the times when you expressed yourself through jumbled, slurred words.
sour grapes, indeed.
http://www.cbc.ca/news/politics/elizabeth-may-green-party-1.4507332
jagmeet singh must cut his beard.
sour grapes, indeed.
http://www.cbc.ca/news/politics/elizabeth-may-green-party-1.4507332
jagmeet singh must cut his beard.
at
13:38
i think trudeau phrased that a little bit frighteningly.
"Sexual harassment is a systemic problem. It is unacceptable. When women speak up, it is our duty to listen to them"
great. perfect statement. every decent person in the world agrees with you. that's what a snazzy politician produces.
"...and to believe them."
gah. you just lost the room, man. i know your strategists are telling you one thing about the political usefulness of projecting feminism, if you want to claim this is feminism, but you've really got the...you've got the entire political spectrum, save the hardest part of the pseudo-left, against you. and, worse, this pseudo-left is really feeding off of the corporate media, which is using the thing, however genuine, as a screen to get rid of people - i don't think it's a witch hunt, so much as i think there's a list, somewhere, and somebody's scratching names off of it. it's a purge. then, there's the opportunists, too.
i don't even completely disagree with him. i mean, sure, you should believe these women....if they're convincing. it's the implication of blanket belief that is rightfully drawing criticism from every direction on the spectrum. not because it's anti-feminist, but because it's inherently irrational.
i'm sure he'd clarify, if presented with an opportunity, that he was speaking in generalities, and not including the exceptions. but he said it in a way that...
either he's not being scripted closely enough, or he's not following it. he shouldn't have said that like that. that's going to freak people out.
it shouldn't, but it will.
but, flip past that and look at the response from the ministers - it's pretty much exactly what you'd want to hear a government say. they were clear to point out the need for due process.
the liberals are consistently legitimately good at governing. i'm way out here in left field, and i have the usual criticisms, but for capitalists? with all their flaws, true enough? there's a level of justified confidence in the party that i think pretty much every major industrialized country has lost, in their center-left.
https://www.theglobeandmail.com/news/politics/trudeau-says-women-who-speak-up-about-sexual-harassment-must-be-believed/article37760006/
jagmeet singh must cut his beard.
"Sexual harassment is a systemic problem. It is unacceptable. When women speak up, it is our duty to listen to them"
great. perfect statement. every decent person in the world agrees with you. that's what a snazzy politician produces.
"...and to believe them."
gah. you just lost the room, man. i know your strategists are telling you one thing about the political usefulness of projecting feminism, if you want to claim this is feminism, but you've really got the...you've got the entire political spectrum, save the hardest part of the pseudo-left, against you. and, worse, this pseudo-left is really feeding off of the corporate media, which is using the thing, however genuine, as a screen to get rid of people - i don't think it's a witch hunt, so much as i think there's a list, somewhere, and somebody's scratching names off of it. it's a purge. then, there's the opportunists, too.
i don't even completely disagree with him. i mean, sure, you should believe these women....if they're convincing. it's the implication of blanket belief that is rightfully drawing criticism from every direction on the spectrum. not because it's anti-feminist, but because it's inherently irrational.
i'm sure he'd clarify, if presented with an opportunity, that he was speaking in generalities, and not including the exceptions. but he said it in a way that...
either he's not being scripted closely enough, or he's not following it. he shouldn't have said that like that. that's going to freak people out.
it shouldn't, but it will.
but, flip past that and look at the response from the ministers - it's pretty much exactly what you'd want to hear a government say. they were clear to point out the need for due process.
the liberals are consistently legitimately good at governing. i'm way out here in left field, and i have the usual criticisms, but for capitalists? with all their flaws, true enough? there's a level of justified confidence in the party that i think pretty much every major industrialized country has lost, in their center-left.
https://www.theglobeandmail.com/news/politics/trudeau-says-women-who-speak-up-about-sexual-harassment-must-be-believed/article37760006/
jagmeet singh must cut his beard.
at
13:13
here's an idea that might actually work, regarding daca. you'll excuse my cynicism, but it's called for.
this is what you need to do: ambush paul ryan somewhere in public - a press conference, or a speech - and pointedly ask him the question that is really at the crux of the issue:
what kind of lobbying sum is required to get you to put the dream act on the floor? what's your price?
then, crowd source the cost and pay it out.
because this is the truth: nothing gets through congress unless it's paid for. the cost may be high. but, let me tell you: congressional leaders will surely change their tune, if you name them the right price.
right now, we're using crowd sourcing to elect politicians. maybe we should think about using it to control them with. and, after a few pay outs, they'll get the hint: these are bribes that they can actually win elections with.
jagmeet singh must cut his beard.
this is what you need to do: ambush paul ryan somewhere in public - a press conference, or a speech - and pointedly ask him the question that is really at the crux of the issue:
what kind of lobbying sum is required to get you to put the dream act on the floor? what's your price?
then, crowd source the cost and pay it out.
because this is the truth: nothing gets through congress unless it's paid for. the cost may be high. but, let me tell you: congressional leaders will surely change their tune, if you name them the right price.
right now, we're using crowd sourcing to elect politicians. maybe we should think about using it to control them with. and, after a few pay outs, they'll get the hint: these are bribes that they can actually win elections with.
jagmeet singh must cut his beard.
at
12:38
so, what am i doing, anyways?
from a distance, it probably seems like i've just fallen through the ground and into a rabbit hole, as i was prancing through the rhetorical field of rhetoric.
yes, the rhetorical field of rhetoric. it's a rhetorical field, remember. of rhetoric.
i think christmas is going to end in the next few days. yeah, it's a long one this year. well, i wanted to deal with all of the alter-reality writing - from 12/1996 to 02/1998 and counting - and, as those who have been following this for a while know, my writing tends to get a little more expansive on, err, holidays.
yes, friday is a holiday. legally. really.
so, i've been maintaining the proper mindset, notwithstanding tolerance, since christmas, preparing myself for the writing in the alter-reality...
....and i actually haven't even started yet.
as we can see, i've ranted here quite a bit, and quite nicely, since the 15th of january, when i closed the audio for the first two periods. today, i've been ranting nearly non-stop for like 18 hours or something - although i'm just about to stop. so, i've done a lot of writing, even if it's not in the topic i was intending. but, what i'm really doing is building a master list of album notes, so that i can pull the parts out that i need as i run through the alter-reality and close.
i need to reiterate that i only have to do this once and that, once it is done, the remaining process wil be much, much smoother.
so, what have i done over the last week?
i've built the first 350 pages of the master list up. the document is currently 700 pages, and has notes going to mid 2015 in it.
at this point, i would guess that the final document (1996-2018) will be around 3000 pages long - word, 8.5"x12", 12 pt - although i only expect to get up to around 1000 by the time i get to actually writing.
which will be when?
march.
christmas will be over before january is.
jagmeet singh must cut his beard.
from a distance, it probably seems like i've just fallen through the ground and into a rabbit hole, as i was prancing through the rhetorical field of rhetoric.
yes, the rhetorical field of rhetoric. it's a rhetorical field, remember. of rhetoric.
i think christmas is going to end in the next few days. yeah, it's a long one this year. well, i wanted to deal with all of the alter-reality writing - from 12/1996 to 02/1998 and counting - and, as those who have been following this for a while know, my writing tends to get a little more expansive on, err, holidays.
yes, friday is a holiday. legally. really.
so, i've been maintaining the proper mindset, notwithstanding tolerance, since christmas, preparing myself for the writing in the alter-reality...
....and i actually haven't even started yet.
as we can see, i've ranted here quite a bit, and quite nicely, since the 15th of january, when i closed the audio for the first two periods. today, i've been ranting nearly non-stop for like 18 hours or something - although i'm just about to stop. so, i've done a lot of writing, even if it's not in the topic i was intending. but, what i'm really doing is building a master list of album notes, so that i can pull the parts out that i need as i run through the alter-reality and close.
i need to reiterate that i only have to do this once and that, once it is done, the remaining process wil be much, much smoother.
so, what have i done over the last week?
i've built the first 350 pages of the master list up. the document is currently 700 pages, and has notes going to mid 2015 in it.
at this point, i would guess that the final document (1996-2018) will be around 3000 pages long - word, 8.5"x12", 12 pt - although i only expect to get up to around 1000 by the time i get to actually writing.
which will be when?
march.
christmas will be over before january is.
jagmeet singh must cut his beard.
at
12:00
oh, and, if it's unclear, the end of qe, combined with the ridiculous tax cuts, means that there will not be a trillion dollar infrastructure bill in the united states - or likely to be any government stimulus over the next several years at all.
jagmeet singh must cut his beard
jagmeet singh must cut his beard
at
11:26
neither party wants to pass this bill.
so, trump floated a ridiculous offer, and the democrats provided a ridiculous response. now, they can credibly blame each other for being ridiculous, and people will buy into it without seeing themselves in the mirror for the literal clowns that they are.
both of these positions are ridiculous.
i would have liked to see this passed in congress. the votes are there, if the speaker would just let it come to the floor. but, trump will reauthorize the order in march, and in the process have himself a good excuse for not building a wall - the democrats won't let him do it.
never mind that he controls the entire government - the democrats won't let him do it.
https://www.bloomberg.com/news/articles/2018-01-25/trump-would-double-daca-to-1-8-million-give-path-to-citizenship
jagmeet singh must cut his beard.
so, trump floated a ridiculous offer, and the democrats provided a ridiculous response. now, they can credibly blame each other for being ridiculous, and people will buy into it without seeing themselves in the mirror for the literal clowns that they are.
both of these positions are ridiculous.
i would have liked to see this passed in congress. the votes are there, if the speaker would just let it come to the floor. but, trump will reauthorize the order in march, and in the process have himself a good excuse for not building a wall - the democrats won't let him do it.
never mind that he controls the entire government - the democrats won't let him do it.
https://www.bloomberg.com/news/articles/2018-01-25/trump-would-double-daca-to-1-8-million-give-path-to-citizenship
jagmeet singh must cut his beard.
at
11:24
no, i'm not shy about this, i've posted it here before, albeit maybe not in a cohesive argument.
if america were serious about immigration reform, what it would do is dismantle ice and redirect the funding to a regulatory body that ensures that employers follow proper hiring practices, and face serious consequences if they don't. i will argue strenuously that, yes, it is an employer's responsibility to determine that their employees are legally allowed to work in the country, and that they should face severe punishment if they are caught breaking that law.
like, jail time.
this is the actual problem: the labour laws aren't being followed, and absolutely nobody is doing anything to ensure that they are. the debate is entirely on the migrants, which is totally backwards.
but, america is not serious about immigration reform. the democrats take their massive checks from their big donors, and look the other way as they exploit workers that literally have absolutely no rights, then argue it should be easier for those corporate donors to exploit those workers. the republicans also look the other way, but they scapegoat them like they're jews in order to quell dissent from the native born population and win votes. neither party has any vested interest in changing the status quo at all; it's just all political theatre on both sides, with no intent to change anything.
i think that nobody is illegal, and free mobility should be universal - globally. but, until we can get rid of capital altogether, the viability of such a system relies on a violent enforcement of labour regulations. migrants deserve a living wage, like everybody else - and native born workers deserve the rights to a collective bargaining process that prevents migrants from undercutting their wages...
there are thousands of immigration officers working for ice. redeploy them to go after the businesses. you'll see immediate results.
but, it will never happen, because nobody wants the status quo to be altered.
jagmeet singh must cut his beard.
if america were serious about immigration reform, what it would do is dismantle ice and redirect the funding to a regulatory body that ensures that employers follow proper hiring practices, and face serious consequences if they don't. i will argue strenuously that, yes, it is an employer's responsibility to determine that their employees are legally allowed to work in the country, and that they should face severe punishment if they are caught breaking that law.
like, jail time.
this is the actual problem: the labour laws aren't being followed, and absolutely nobody is doing anything to ensure that they are. the debate is entirely on the migrants, which is totally backwards.
but, america is not serious about immigration reform. the democrats take their massive checks from their big donors, and look the other way as they exploit workers that literally have absolutely no rights, then argue it should be easier for those corporate donors to exploit those workers. the republicans also look the other way, but they scapegoat them like they're jews in order to quell dissent from the native born population and win votes. neither party has any vested interest in changing the status quo at all; it's just all political theatre on both sides, with no intent to change anything.
i think that nobody is illegal, and free mobility should be universal - globally. but, until we can get rid of capital altogether, the viability of such a system relies on a violent enforcement of labour regulations. migrants deserve a living wage, like everybody else - and native born workers deserve the rights to a collective bargaining process that prevents migrants from undercutting their wages...
there are thousands of immigration officers working for ice. redeploy them to go after the businesses. you'll see immediate results.
but, it will never happen, because nobody wants the status quo to be altered.
jagmeet singh must cut his beard.
at
11:06
actually, i'm glad i'm getting the opportunity to live blog america's fall.
it's kind of a wet dream for an asexual, actually.
no, really.
i mean, it's inevitable. but i didn't think i'd get to see it.
or gloat about it.
jagmeet singh must cut his beard.
it's kind of a wet dream for an asexual, actually.
no, really.
i mean, it's inevitable. but i didn't think i'd get to see it.
or gloat about it.
jagmeet singh must cut his beard.
at
09:57
so, after turkey, who will be the next us ally to bail on america,
both for it's shrinking influence and it's dishonest provocations?
the germans will move once the gates are open, and that will likely be the point of no return. they are slowly, but surely, moving to align themselves more closely with the russians.
i'm going with japan as the second major defection, spurred on by annoyance over the tpp and the desire to tap into the chinese market, which is rapidly increasing it's amount of disposable income. and, they will take the south koreans with them.
the sun will set on the american empire.
http://www.hurriyetdailynews.com/china-says-it-hopes-to-get-japan-ties-back-on-track-126409
https://www.bloomberg.com/news/articles/2018-01-28/china-sees-obstacles-to-repairing-ties-with-japan-as-envoys-meet
https://www.rferl.org/a/nord-stream-2-u-s-poland-oppose-russia-germany/29002097.html
jagmeet singh must cut his beard
the germans will move once the gates are open, and that will likely be the point of no return. they are slowly, but surely, moving to align themselves more closely with the russians.
i'm going with japan as the second major defection, spurred on by annoyance over the tpp and the desire to tap into the chinese market, which is rapidly increasing it's amount of disposable income. and, they will take the south koreans with them.
the sun will set on the american empire.
http://www.hurriyetdailynews.com/china-says-it-hopes-to-get-japan-ties-back-on-track-126409
https://www.bloomberg.com/news/articles/2018-01-28/china-sees-obstacles-to-repairing-ties-with-japan-as-envoys-meet
https://www.rferl.org/a/nord-stream-2-u-s-poland-oppose-russia-germany/29002097.html
jagmeet singh must cut his beard
at
09:47
i will accept the argument that qe might have an effect in preventing deflation, which is what you would actually expect in a situation where:
1) the money is trickling up.
2) the population is increasing.
3) the money supply is stagnant.
in that situation, more mouths to feed and less money to go around should lead to deflation, as people have less to spend - or it least it should under market conditions. and, people are probably actually going to mark the food down if people can't pay for it, yes.
the elite might not care, except that the corollary of such a situation is civil unrest, and that's likely the actual reason underlying the policy.
but, it also cuts to the criticism that obama's stimulus was too small. i mean, i'm sure he had lots of political discussions about the size of the stimulus, and how it might be a liability for fiscally conservative democrats. but, the numbers picked were lower than suggested - and lower than the near simultaneous stimulus announced by the chinese, who seem to have been legitimately concerned about growth.
america's stimulus seems to have rather been about preventing deflation. meaning that this qe was just designed to stop the ship from sinking, not get it up and sailing again. meaning that even if you have faith in the market to set things right once the government has intervened, a faith borne out of zero evidence, and a faith that i do not hold, it still follows that the stimulus that is being withdrawn was too small to put the market on the right footing, in the first place.
to be clear: i'm going to argue that the economy needs stimulus all of the time, no matter what and that qe should be permanent. more moderate keynesians will suggest that the government only needs to intervene when investment dries up, and that once the economy is back on it's feet, the stimulus can be withdrawn. ok. but, even those that accept the more moderate position are mostly going to argue that the stimulus was too small to get the economy back on it's feet, and was really only enough to put off the inevitable deflationary spiral that going bareback for too long will inevitably produce.
this is bad policy, all around. and, i know the business press has it's head stuck up it's ass. but wait for it.
this is the reason that they tell you that leftists don't understand the economy.
jagmeet singh must cut his beard.
1) the money is trickling up.
2) the population is increasing.
3) the money supply is stagnant.
in that situation, more mouths to feed and less money to go around should lead to deflation, as people have less to spend - or it least it should under market conditions. and, people are probably actually going to mark the food down if people can't pay for it, yes.
the elite might not care, except that the corollary of such a situation is civil unrest, and that's likely the actual reason underlying the policy.
but, it also cuts to the criticism that obama's stimulus was too small. i mean, i'm sure he had lots of political discussions about the size of the stimulus, and how it might be a liability for fiscally conservative democrats. but, the numbers picked were lower than suggested - and lower than the near simultaneous stimulus announced by the chinese, who seem to have been legitimately concerned about growth.
america's stimulus seems to have rather been about preventing deflation. meaning that this qe was just designed to stop the ship from sinking, not get it up and sailing again. meaning that even if you have faith in the market to set things right once the government has intervened, a faith borne out of zero evidence, and a faith that i do not hold, it still follows that the stimulus that is being withdrawn was too small to put the market on the right footing, in the first place.
to be clear: i'm going to argue that the economy needs stimulus all of the time, no matter what and that qe should be permanent. more moderate keynesians will suggest that the government only needs to intervene when investment dries up, and that once the economy is back on it's feet, the stimulus can be withdrawn. ok. but, even those that accept the more moderate position are mostly going to argue that the stimulus was too small to get the economy back on it's feet, and was really only enough to put off the inevitable deflationary spiral that going bareback for too long will inevitably produce.
this is bad policy, all around. and, i know the business press has it's head stuck up it's ass. but wait for it.
this is the reason that they tell you that leftists don't understand the economy.
jagmeet singh must cut his beard.
at
07:58
i guess i missed this.
when the economy crashes in a year or two, this will be the reason why, and not the tax cuts. america could go to a 0% federal tax rate without affecting the economy, so long as it prints what it needs - and can find somebody to buy the debt. but, when the country stops printing money, the economy will always start falling apart before the next election happens. it's a very short time window before the effects are felt.
"capitalism requires capital!".
and, perhaps it really is that simple. but, you can make this argument a dozen different ways...
i mean, i could run through the mmt charts.
but, i think even something as simple as population growth is a reason for permanent quantitative easing. and, maybe nobody has presented this to you, this way. i'm always surprised by how many activists sound like ron paul, when the topic of banks come up - probably because it's the only information they've ever received on the topic.
just think it through.
every given year, the following things happen:
1) the number of people in the country increases.
2) the value of the dollar decreases relative to itself (this is called inflation).
so, just through simple population increases, a roughly fixed money supply would mean that, year-over-year, there is going to be less money to go around, and it will be worth less. so, gdp per capita has nowhere to go but down.
now, you can argue inflation can be minimized (and i'm not going to take your arguments seriously, as there is no evidence at all that quantitative easing does cause inflation, despite many attempts to force it to; it's usually the reason it's brought in...) by reducing the money supply, or eliminating the ability to manipulate it, but you can't make that argument about population growth. if you don't increase the money supply to compensate for population growth, you're going to run out of money; if you have x dollars, and you split it fairly amongst y people, you're going to need a lot more than x dollars to split it just as fairly amongst y^2 people, and if you only have x dollars then the result is going to be a recession...
you won't find that in a textbook, but it's maybe the easiest way to understand the necessity of qe in the existing capitalist economy - and the sheer logic underlying the policy.
https://www.ft.com/content/caf45d6a-9e28-11e7-8cd4-932067fbf946
jagmeet singh must cut his beard.
when the economy crashes in a year or two, this will be the reason why, and not the tax cuts. america could go to a 0% federal tax rate without affecting the economy, so long as it prints what it needs - and can find somebody to buy the debt. but, when the country stops printing money, the economy will always start falling apart before the next election happens. it's a very short time window before the effects are felt.
"capitalism requires capital!".
and, perhaps it really is that simple. but, you can make this argument a dozen different ways...
i mean, i could run through the mmt charts.
but, i think even something as simple as population growth is a reason for permanent quantitative easing. and, maybe nobody has presented this to you, this way. i'm always surprised by how many activists sound like ron paul, when the topic of banks come up - probably because it's the only information they've ever received on the topic.
just think it through.
every given year, the following things happen:
1) the number of people in the country increases.
2) the value of the dollar decreases relative to itself (this is called inflation).
so, just through simple population increases, a roughly fixed money supply would mean that, year-over-year, there is going to be less money to go around, and it will be worth less. so, gdp per capita has nowhere to go but down.
now, you can argue inflation can be minimized (and i'm not going to take your arguments seriously, as there is no evidence at all that quantitative easing does cause inflation, despite many attempts to force it to; it's usually the reason it's brought in...) by reducing the money supply, or eliminating the ability to manipulate it, but you can't make that argument about population growth. if you don't increase the money supply to compensate for population growth, you're going to run out of money; if you have x dollars, and you split it fairly amongst y people, you're going to need a lot more than x dollars to split it just as fairly amongst y^2 people, and if you only have x dollars then the result is going to be a recession...
you won't find that in a textbook, but it's maybe the easiest way to understand the necessity of qe in the existing capitalist economy - and the sheer logic underlying the policy.
https://www.ft.com/content/caf45d6a-9e28-11e7-8cd4-932067fbf946
jagmeet singh must cut his beard.
at
07:32
yeah.
the tax cuts won't do much at all, but the end of quantitative easing is certainly going to kickstart a recession. the american form of capitalism requires quantitative easing, and will collapse without it. or, at least that's what empiricism teaches us.
i actually didn't expect that from trump, and hope the article is reaching a little. i expected him to throw money around all over the place, and print what he needed. tax cuts. boosts in military spending. how do you make up the difference? i guess i assumed that trump would walk down the same path as reagan: truly believe that government is spending too much on poor people and not enough on guns, then cut everything you possibly can besides the guns, then realize the government barely spends any money on poor people at all and is actually spending all it's money on guns and so instead just print even more money for the guns, without bothering to restore funding to poor people. that's how republicans do this, right?
and, we got the expected bill. i mean, maybe that's why i didn't bother to analyse it or even read it - it's exactly what i expected. we got the military increases. we got the tax cuts. we got the slashing of services. the next thing that a republican is supposed to do is print the money to offset the tax cuts...
again: maybe he still will. maybe this is reaching.
but, he did just replace the fed chair.
and, i did tell you he was going to dismantle the empire.
what happens after quantitative easing stops is going to look a lot like the end days of the soviet union for a lot of people, even if it doesn't lead to political reform - or at least not immediately.
https://www.theguardian.com/business/2018/jan/26/imf-chief-warns-trumps-tax-cuts-could-destabilise-global-economy
jagmeet singh must cut his beard.
the tax cuts won't do much at all, but the end of quantitative easing is certainly going to kickstart a recession. the american form of capitalism requires quantitative easing, and will collapse without it. or, at least that's what empiricism teaches us.
i actually didn't expect that from trump, and hope the article is reaching a little. i expected him to throw money around all over the place, and print what he needed. tax cuts. boosts in military spending. how do you make up the difference? i guess i assumed that trump would walk down the same path as reagan: truly believe that government is spending too much on poor people and not enough on guns, then cut everything you possibly can besides the guns, then realize the government barely spends any money on poor people at all and is actually spending all it's money on guns and so instead just print even more money for the guns, without bothering to restore funding to poor people. that's how republicans do this, right?
and, we got the expected bill. i mean, maybe that's why i didn't bother to analyse it or even read it - it's exactly what i expected. we got the military increases. we got the tax cuts. we got the slashing of services. the next thing that a republican is supposed to do is print the money to offset the tax cuts...
again: maybe he still will. maybe this is reaching.
but, he did just replace the fed chair.
and, i did tell you he was going to dismantle the empire.
what happens after quantitative easing stops is going to look a lot like the end days of the soviet union for a lot of people, even if it doesn't lead to political reform - or at least not immediately.
https://www.theguardian.com/business/2018/jan/26/imf-chief-warns-trumps-tax-cuts-could-destabilise-global-economy
jagmeet singh must cut his beard.
at
07:01
in case i haven't been clear: i would have voted against brexit, for the reason that it's not likely to actually solve anything. the same bankers end up in control, in the end. it's going to be mostly smoke and mirrors, by the time it's done. but, now that it is upon britain, i think there's certainly a lot of tweaks that could be made to improve the condition of the british working class. i guess you could say i would have been in favour of renegotiating terms, rather than fully withdrawing.
i don't expect this to turn out to my liking. i guess that's the other reason i would have voted against it.
on an issue by issue basis...
1) free movement of goods: no. get rid of that.
2) free movement of capital: no. get rid of that.
3) free movement of labour: yes. maintain this.
4) customs union: no. get rid of that.
what will actually happen, probably?
1) free movement of goods: this will likely be restricted.
2) free movement of capital: this will likely be maintained.
3) free movement of labour: this will likely be restricted dramatically.
4) customs union: the british will likely synchronize their tariffs, one way or the other.
but, that doesn't mean i can't agitate.
jagmeet singh must cut his beard.
i don't expect this to turn out to my liking. i guess that's the other reason i would have voted against it.
on an issue by issue basis...
1) free movement of goods: no. get rid of that.
2) free movement of capital: no. get rid of that.
3) free movement of labour: yes. maintain this.
4) customs union: no. get rid of that.
what will actually happen, probably?
1) free movement of goods: this will likely be restricted.
2) free movement of capital: this will likely be maintained.
3) free movement of labour: this will likely be restricted dramatically.
4) customs union: the british will likely synchronize their tariffs, one way or the other.
but, that doesn't mean i can't agitate.
jagmeet singh must cut his beard.
at
06:38
thank god* for vice news.
https://www.vice.com/en_uk/article/gq9m9j/he-left-wing-arguments-on-the-eu-referendum-brexit-for-against
jagmeet singh must cut his beard.
*clearly, there is no such thing as god.
https://www.vice.com/en_uk/article/gq9m9j/he-left-wing-arguments-on-the-eu-referendum-brexit-for-against
jagmeet singh must cut his beard.
*clearly, there is no such thing as god.
at
04:51
see, i think labour ought to be using the xenophobia as a wedge issue. if it becomes the ballot question, it could both help ukip split the vote and increase the turnout by both creating a movement amongst often non-voters and really riling up the base.
it requires some careful framing, but there's no issue more populist than fighting xenophobia.
maybe some hard numbers from internal polling might make me rethink it. but, if it were me, my thought process would be something like "what do i care if i piss off some white trash tory voters?".
i know, not very statespersonlike. whatever. politics is a dirty business.
https://www.theguardian.com/commentisfree/2017/dec/12/brexit-jeremy-corbyn-keir-starmer-labour
jagmeet singh must cut his beard.
it requires some careful framing, but there's no issue more populist than fighting xenophobia.
maybe some hard numbers from internal polling might make me rethink it. but, if it were me, my thought process would be something like "what do i care if i piss off some white trash tory voters?".
i know, not very statespersonlike. whatever. politics is a dirty business.
https://www.theguardian.com/commentisfree/2017/dec/12/brexit-jeremy-corbyn-keir-starmer-labour
jagmeet singh must cut his beard.
at
04:47
yeah, i can't imagine the british signing up to a system that they pay into without have voting powers, given that they still like to pretend they're a colonial power. they couldn't deal with that.
i mean, they have a veto at the united nations. you're going to tell them they can't vote on cheese tariffs?
the canada-style deal is, indeed, the better option, but i don't agree that the single market is an indivisible idea. i don't see any reason why corbyn can't push for the free flow of labour, while denying the free flow of goods and capital. i mean, he's in opposition, he can be a little loud about something that might be hard to negotiate, right?
i think he might find that this liberal opposition he's facing is mostly concerned about britain losing it's cosmopolitan character, rather than about the economics of the situation. and, so long as demand settles, brexit shouldn't directly harm the british economy, once production relocates or transforms itself accordingly to meet demand. job losses is what the establishment always says when it's facing a backlash. we can't get rid of oil, because jobs. we can't get rid of war, because jobs. so why is it a surprise that we can't get rid of the eu, because jobs? and it shouldn't be a surprise when that turns out to be the same old contrived bullshit, either. jobs are created by demand...
britain was key in the industrial revolution, remember. this was a society that was built on the strength of exports to foreign markets (often opened with gun boats). but, if they're going to bring production back, maybe they can clean it up this time. and, maybe it could even act as a model for a new industrial revolution, to sustainability.
if i'm right, and the opposition to brexit is more cultural than economic, while the support for brexit is mostly economic, he can probably get away with opposing brexit on cultural terms and supporting it on economic ones, if he just focuses his agitation on that one point of maintaining free mobility, if he can win the argument that the real cause of migrants stealing jobs is employers that don't follow labour laws.
it's lonely out here on the left, sometimes. this probably sounds delusional, even if i'm right, as i usually am.
http://www.telegraph.co.uk/politics/2018/01/27/canada-style-brexit-deal-obvious-rapid-solution/
jagmeet singh must cut his beard.
i mean, they have a veto at the united nations. you're going to tell them they can't vote on cheese tariffs?
the canada-style deal is, indeed, the better option, but i don't agree that the single market is an indivisible idea. i don't see any reason why corbyn can't push for the free flow of labour, while denying the free flow of goods and capital. i mean, he's in opposition, he can be a little loud about something that might be hard to negotiate, right?
i think he might find that this liberal opposition he's facing is mostly concerned about britain losing it's cosmopolitan character, rather than about the economics of the situation. and, so long as demand settles, brexit shouldn't directly harm the british economy, once production relocates or transforms itself accordingly to meet demand. job losses is what the establishment always says when it's facing a backlash. we can't get rid of oil, because jobs. we can't get rid of war, because jobs. so why is it a surprise that we can't get rid of the eu, because jobs? and it shouldn't be a surprise when that turns out to be the same old contrived bullshit, either. jobs are created by demand...
britain was key in the industrial revolution, remember. this was a society that was built on the strength of exports to foreign markets (often opened with gun boats). but, if they're going to bring production back, maybe they can clean it up this time. and, maybe it could even act as a model for a new industrial revolution, to sustainability.
if i'm right, and the opposition to brexit is more cultural than economic, while the support for brexit is mostly economic, he can probably get away with opposing brexit on cultural terms and supporting it on economic ones, if he just focuses his agitation on that one point of maintaining free mobility, if he can win the argument that the real cause of migrants stealing jobs is employers that don't follow labour laws.
it's lonely out here on the left, sometimes. this probably sounds delusional, even if i'm right, as i usually am.
http://www.telegraph.co.uk/politics/2018/01/27/canada-style-brexit-deal-obvious-rapid-solution/
jagmeet singh must cut his beard.
at
04:22
let's not go back in time and talk about andrew jackson, who, excluding washington, was probably the closest thing america has had to a king.
the real demographic split hasn't changed, not through all the shifts in american history, not through slavery, not through civil rights - the democrats remain the party of the educated elite, while the republicans generate the bulk of their support from the masses. you can pull out different alliances. but, you're more likely to meet a democrat at a high gala event, whereas you're more likely to meet a republican in a small town working class tavern.
because this was always the real divide in british politics: between the party of the court and the party of the people.
jagmeet singh must cut his beard.
the real demographic split hasn't changed, not through all the shifts in american history, not through slavery, not through civil rights - the democrats remain the party of the educated elite, while the republicans generate the bulk of their support from the masses. you can pull out different alliances. but, you're more likely to meet a democrat at a high gala event, whereas you're more likely to meet a republican in a small town working class tavern.
because this was always the real divide in british politics: between the party of the court and the party of the people.
jagmeet singh must cut his beard.
at
03:54
it's just...
after decades of having the socialist party overrun by liberals, the party membership finally gets it's machinery back, maybe, at least it finally has somebody that has left-leaning instincts, and as soon as he makes a stand in favour of native workers, he has to deal with protest from liberals inside his own party.
they're in the wrong party.
they're liberals.
tell 'em to piss off, and to go back where they came from...
jagmeet singh must cut his beard.
after decades of having the socialist party overrun by liberals, the party membership finally gets it's machinery back, maybe, at least it finally has somebody that has left-leaning instincts, and as soon as he makes a stand in favour of native workers, he has to deal with protest from liberals inside his own party.
they're in the wrong party.
they're liberals.
tell 'em to piss off, and to go back where they came from...
jagmeet singh must cut his beard.
at
03:35
for those that don't follow british politics...
there was of course a liberal party in britain back in the day, from which both the canadian liberal party and the american republican party claim ultimate descent, with the republicans doing so through the whigs. the democrats can't really claim historical descent from the conservative party, but they have usually been more like conservatives than liberals. in traditional british politics, blue means right-wing (with it's monarchist tendencies) and red means left-wing (this is of the people), so long as we're not eating bread at the circus, in which case they're both the same, anyways..
somebody might get me on a technicality, but i believe that the last liberal prime minister of the united kingdom was neville chamberlin, who casual readers of history no doubt know solely through his fascist appeasement policies and subsequent declaration of war against germany in 1939. the brits never forgave him for this, and the liberals were replaced by labour - a socialist party - after the war. the early years of ingsoc had some positive influence in britain, as well - even if the most socialist thing they did was allow the empire to collapse without a fight.
the liberals sputtered for decades, after that, before merging with a smaller party in i believe the 80s to form the liberal democrats. but, this is basically the continuation of the party of gladstone. it's still there, man.
this is where the remainers ought to vote, if they want to uphold the neo-liberal status quo. and, it's rational. you want liberalism? vote liberal.
that should be the campaign slogan. at the end of the ads.
are you a liberal? then vote Liberal.
http://www.independent.co.uk/news/uk/politics/liberal-democrats-challenge-labour-european-single-market-vote-parliament-brexit-latest-a7915106.html
jagmeet singh must cut his beard.
there was of course a liberal party in britain back in the day, from which both the canadian liberal party and the american republican party claim ultimate descent, with the republicans doing so through the whigs. the democrats can't really claim historical descent from the conservative party, but they have usually been more like conservatives than liberals. in traditional british politics, blue means right-wing (with it's monarchist tendencies) and red means left-wing (this is of the people), so long as we're not eating bread at the circus, in which case they're both the same, anyways..
somebody might get me on a technicality, but i believe that the last liberal prime minister of the united kingdom was neville chamberlin, who casual readers of history no doubt know solely through his fascist appeasement policies and subsequent declaration of war against germany in 1939. the brits never forgave him for this, and the liberals were replaced by labour - a socialist party - after the war. the early years of ingsoc had some positive influence in britain, as well - even if the most socialist thing they did was allow the empire to collapse without a fight.
the liberals sputtered for decades, after that, before merging with a smaller party in i believe the 80s to form the liberal democrats. but, this is basically the continuation of the party of gladstone. it's still there, man.
this is where the remainers ought to vote, if they want to uphold the neo-liberal status quo. and, it's rational. you want liberalism? vote liberal.
that should be the campaign slogan. at the end of the ads.
are you a liberal? then vote Liberal.
http://www.independent.co.uk/news/uk/politics/liberal-democrats-challenge-labour-european-single-market-vote-parliament-brexit-latest-a7915106.html
jagmeet singh must cut his beard.
at
03:29
it's some serious mental gymnastics to argue that opposing a free trade deal, and not supporting a single market, is in some way a betrayal of socialist values.
the british didn't lose their liberal party, it just fell into disuse. but, this is a good reason to bring it back. and, that is what i would say to the remainers: if you're so in love with neo-liberalism, why don't you marry it? why don't you join the liberal party?
i understand that the party wants to win elections. but, they really ought to take a stand on this, and go tell these liberals to be liberals, and stop the doublespeak around the situation. there's not a socialist on the planet that supports the euro. i mean a lot of us don't even support the concept of currency.
that said, there are aspects of the eurozone that most socialists would support, and that activists should be pushing labour to try and maintain some kind of continuity on. free mobility, for example, is certainly a socialist aim. i understand that the push back was largely about open immigration, and what the british people really said was that barely half of the people that voted wanted to restore some sovereignty around immigration. so, there's a large minority of voters that want less immigration. but, as a long-time opponent of nafta, i actually think that one of the major problems of nafta - that it created a lot of economic migrants - would be best solved with the kind of mobility rights that exist in the european union. i mean, that would be one of my major fixes for nafta: it should have eu-style free mobility. i've made that argument forcefully, for years. not decades, but maybe a decade. such free mobility would actually make it easier for workers to be tracked as they cross borders and harder for unscrupulous employers - which are the actual problem - to evade labour laws. what the british people are going to see, in the event of stricter limits on immigration, is a situation more comparable to the southern parts of the united states, where illegal migrants work without legal protections and under the table. employers will benefit. but this is going to actually exacerbate the economic problems that created the backlash vote in the first place. labour ought to be trying to win this argument, but, instead, they're not making it.
socialists, however, are not concerned about things like religious freedom, as we seek to abolish religion, and multiculturalism, as we seek to abolish nationalism. this is all boiler-plate liberal bullshit. so, these people should be told where they ought to go with it.
jagmeet singh must cut his beard.
the british didn't lose their liberal party, it just fell into disuse. but, this is a good reason to bring it back. and, that is what i would say to the remainers: if you're so in love with neo-liberalism, why don't you marry it? why don't you join the liberal party?
i understand that the party wants to win elections. but, they really ought to take a stand on this, and go tell these liberals to be liberals, and stop the doublespeak around the situation. there's not a socialist on the planet that supports the euro. i mean a lot of us don't even support the concept of currency.
that said, there are aspects of the eurozone that most socialists would support, and that activists should be pushing labour to try and maintain some kind of continuity on. free mobility, for example, is certainly a socialist aim. i understand that the push back was largely about open immigration, and what the british people really said was that barely half of the people that voted wanted to restore some sovereignty around immigration. so, there's a large minority of voters that want less immigration. but, as a long-time opponent of nafta, i actually think that one of the major problems of nafta - that it created a lot of economic migrants - would be best solved with the kind of mobility rights that exist in the european union. i mean, that would be one of my major fixes for nafta: it should have eu-style free mobility. i've made that argument forcefully, for years. not decades, but maybe a decade. such free mobility would actually make it easier for workers to be tracked as they cross borders and harder for unscrupulous employers - which are the actual problem - to evade labour laws. what the british people are going to see, in the event of stricter limits on immigration, is a situation more comparable to the southern parts of the united states, where illegal migrants work without legal protections and under the table. employers will benefit. but this is going to actually exacerbate the economic problems that created the backlash vote in the first place. labour ought to be trying to win this argument, but, instead, they're not making it.
socialists, however, are not concerned about things like religious freedom, as we seek to abolish religion, and multiculturalism, as we seek to abolish nationalism. this is all boiler-plate liberal bullshit. so, these people should be told where they ought to go with it.
jagmeet singh must cut his beard.
at
02:54
and, should america be angry with the turks for their betrayal?
the turks have actually been very compliant allies, and they had to be, because they were all of a sudden back to where they were in the fourteenth century, and under imminent threat of russian invasion of the dardanelles. there was a war in greece over this, right after world war two. without western support, turkey would have certainly become a soviet socialist republic. it was the first major proxy conflict of the cold war.
and, since then, turkey has been compliant because they've been reliant. i've gone through great lengths here to stress turkey's role as a european power, and one half of the legacy of the byzantine empire - the geographic half, if not the cultural half. hey, listen - the turkish emperors themselves were well aware of this, and picked up where the romans left off, launching multiple invasions of rome to try and unite the empire.
historical reality is that if the turks had succeeded in conquering italy, they would have almost certainly moved their capital to rome, and what i'm saying here would be mainstream history, although it's not particularly obscure, as it is.
the turks demonstrated every inclination that they wanted to be an important part of the western alliance, from the embrace of secularism to the construction of important nato military facilities. they've fought and died in western wars.
but, now, we see what america has done - and this is obama's fault - to spit in the face of this willing and compliant ally, in backing extremists funded by the saudi theocracy to redraw the maps in the middle east, in ways that put the very premise of turkish civilization under existential threat. much of the fighting in the syrian war was between turkish-backed groups and saudi-backed groups for control over who gets to recreate syria in their image, in the then-perceived vacuum of russian power, with the americans overwhelmingly supporting the saudi-backed groups, which convincingly defeated the turkish-backed groups, before the russians came in and beat the saudi-backed groups. the turks have been fighting a proxy war against deep american interests the whole time! it may have taken them a few years to understand this, as no doubt nobody told them. so, some allies. america has refused to take these concerns seriously, to the point that it has essentially been treating turkey like an adversary - just another bunch of barbarians to divide and set at each other.
erdogan is dumb as a plank, but he's right about this: this is not the behaviour of an ally. it is the behaviour of an imperial force set on setting everybody against each other. the turks do not have real friends or serious allies in washington.
to put it another way, turkey may have demonstrated enthusiastic willingness to be in the empire, but the empire has refused to consolidate turkey within it, instead seeing them as outsiders - barbarians with weird customs that need to be kept in a state of inter-warfare to prevent them from challenging american interests. america would be just as happy to see turkey collapse into a set of buffer states.
no, do not blame turkey. this is america's fault.
and, it's america's addiction to oil's fault.
jagmeet singh must cut his beard.
the turks have actually been very compliant allies, and they had to be, because they were all of a sudden back to where they were in the fourteenth century, and under imminent threat of russian invasion of the dardanelles. there was a war in greece over this, right after world war two. without western support, turkey would have certainly become a soviet socialist republic. it was the first major proxy conflict of the cold war.
and, since then, turkey has been compliant because they've been reliant. i've gone through great lengths here to stress turkey's role as a european power, and one half of the legacy of the byzantine empire - the geographic half, if not the cultural half. hey, listen - the turkish emperors themselves were well aware of this, and picked up where the romans left off, launching multiple invasions of rome to try and unite the empire.
historical reality is that if the turks had succeeded in conquering italy, they would have almost certainly moved their capital to rome, and what i'm saying here would be mainstream history, although it's not particularly obscure, as it is.
the turks demonstrated every inclination that they wanted to be an important part of the western alliance, from the embrace of secularism to the construction of important nato military facilities. they've fought and died in western wars.
but, now, we see what america has done - and this is obama's fault - to spit in the face of this willing and compliant ally, in backing extremists funded by the saudi theocracy to redraw the maps in the middle east, in ways that put the very premise of turkish civilization under existential threat. much of the fighting in the syrian war was between turkish-backed groups and saudi-backed groups for control over who gets to recreate syria in their image, in the then-perceived vacuum of russian power, with the americans overwhelmingly supporting the saudi-backed groups, which convincingly defeated the turkish-backed groups, before the russians came in and beat the saudi-backed groups. the turks have been fighting a proxy war against deep american interests the whole time! it may have taken them a few years to understand this, as no doubt nobody told them. so, some allies. america has refused to take these concerns seriously, to the point that it has essentially been treating turkey like an adversary - just another bunch of barbarians to divide and set at each other.
erdogan is dumb as a plank, but he's right about this: this is not the behaviour of an ally. it is the behaviour of an imperial force set on setting everybody against each other. the turks do not have real friends or serious allies in washington.
to put it another way, turkey may have demonstrated enthusiastic willingness to be in the empire, but the empire has refused to consolidate turkey within it, instead seeing them as outsiders - barbarians with weird customs that need to be kept in a state of inter-warfare to prevent them from challenging american interests. america would be just as happy to see turkey collapse into a set of buffer states.
no, do not blame turkey. this is america's fault.
and, it's america's addiction to oil's fault.
jagmeet singh must cut his beard.
at
01:27
Saturday, January 27, 2018
woah.
listen.....
what the russians want is clear enough: they want to return territorial sovereignty to syria, to recreate the sykes-picot lines and return the map to what it was before the mess started. the americans are obviously arming the kurds because they don't want to do that, they want the map erased and redrawn, to reflect what their arab allies believe is a better understanding of demography and history. for, the sykes-picot lines were clearly arbitrary.
lets try a thought experiment: what if the americans had succeeded in using these extremists to overthrow assad? the kurds would have been abandoned immediately, or at least expelled to an enclave in the north. the whole point of this was to back saudi ambitions for a pan-arabic, fundamentalist state; the kurds would not be welcome in such a hypothetical society. it's not the middle ages, any more. the end result would have been the abolition of national boundaries in the region, and perhaps a kurdish state centred around mosul. certainly, the americans never planned for the kurds to move into syria, it's just something that kind of happened, largely in reaction to the russians setting up. the americans found themselves in a race to occupy as much of the country as possible.
so, when the russians told the kurdish militants "hand the region back to assad or be driven out.", it was done with the intent to re-establish the international rule of law, and reconstruct the nation state of syria, with a capital in damascus.
the russians are up against a wall in terms of what they can actually do. if the status quo persists, there is a real threat of syria fracturing like korea and vietnam did in the cold war, and the kurdish enclave becoming an american military base, like south korea is. notwithstanding the fact that this would be bad for syria, it is not in russian interests to split syria down the middle like this. but, they can't act directly against america, either.
the turks are in charge of doing this precisely because it won't set off a world war, due to the close alliance with washington; ankara can get away with things that moscow cannot. and, their task appears to be to set up a buffer zone separating russian and american forces, thereby allowing the regime to consolidate the regions behind the buffer zone, and ultimately prepare to reunite the country.
jagmeet singh must cut his beard
listen.....
what the russians want is clear enough: they want to return territorial sovereignty to syria, to recreate the sykes-picot lines and return the map to what it was before the mess started. the americans are obviously arming the kurds because they don't want to do that, they want the map erased and redrawn, to reflect what their arab allies believe is a better understanding of demography and history. for, the sykes-picot lines were clearly arbitrary.
lets try a thought experiment: what if the americans had succeeded in using these extremists to overthrow assad? the kurds would have been abandoned immediately, or at least expelled to an enclave in the north. the whole point of this was to back saudi ambitions for a pan-arabic, fundamentalist state; the kurds would not be welcome in such a hypothetical society. it's not the middle ages, any more. the end result would have been the abolition of national boundaries in the region, and perhaps a kurdish state centred around mosul. certainly, the americans never planned for the kurds to move into syria, it's just something that kind of happened, largely in reaction to the russians setting up. the americans found themselves in a race to occupy as much of the country as possible.
so, when the russians told the kurdish militants "hand the region back to assad or be driven out.", it was done with the intent to re-establish the international rule of law, and reconstruct the nation state of syria, with a capital in damascus.
the russians are up against a wall in terms of what they can actually do. if the status quo persists, there is a real threat of syria fracturing like korea and vietnam did in the cold war, and the kurdish enclave becoming an american military base, like south korea is. notwithstanding the fact that this would be bad for syria, it is not in russian interests to split syria down the middle like this. but, they can't act directly against america, either.
the turks are in charge of doing this precisely because it won't set off a world war, due to the close alliance with washington; ankara can get away with things that moscow cannot. and, their task appears to be to set up a buffer zone separating russian and american forces, thereby allowing the regime to consolidate the regions behind the buffer zone, and ultimately prepare to reunite the country.
jagmeet singh must cut his beard
at
23:30
my initial reaction to trump skipping out on the tpp was something like:
he has no understanding of what he's doing, but if he wants to go ahead and accelerate the decline of america as an empire, i'm not going to put up much of a fight.
this reaction is repeating itself around the world.
and, as i predicted in 2016, trump is, indeed, in the process of unravelling this empire.
it's not entirely his fault. all of these things were put in motion under obama. but, he is an example of the perils of electing exactly the wrong leader at exactly the wrong time. and, the results will reverberate across the centuries.
jagmeet singh must cut his beard.
he has no understanding of what he's doing, but if he wants to go ahead and accelerate the decline of america as an empire, i'm not going to put up much of a fight.
this reaction is repeating itself around the world.
and, as i predicted in 2016, trump is, indeed, in the process of unravelling this empire.
it's not entirely his fault. all of these things were put in motion under obama. but, he is an example of the perils of electing exactly the wrong leader at exactly the wrong time. and, the results will reverberate across the centuries.
jagmeet singh must cut his beard.
at
22:10
For his part, Aldar Khalil, the co-chair of the Movement of a Democratic Society in Afrin, has been quite vocal about Moscow’s strategy. “Syrian Kurdish forces were given an ultimatum over the weekend,” Khalil said. “[We were told] leave your positions to the Syrian regime or face the wrath of Ankara. They chose to stay."
activists on the ground: yes, turkey is still in nato. but, it's a formality, at this point.
the turks are currently actively acting against american interests, and actively aligning with the russians.
i know that you're used to seeing nato as this monolithic thing, where orders are barked from washington. but, this started to break down in the bush administration, was band-aid-ed over by obama, even as he put events in motion that would ultimately weaken american leadership, and has now completely imploded, fairly quickly, under trump. the return of russian power is a consequence of a lack of american leadership, more so than it is a complicating factor.
a return to a multipolar world doesn't and shouldn't change basic political allegiances, and the rojava are certainly worth standing in solidarity with, whatever their flaws. but, it calls for a sharper analysis and a more careful attention to details.
the old alliances are just that, now: old alliances. and, turkey's re-alignment is likely the beginning of things, rather than an isolated happening.
the turks have reason to align with the persian empire - and the kurds are likely the power that will return the persians to empire, one day. but, the russians cannot align with the persians, these are historically competitive empires. they can dominate the persians, they can act as a counter-balance to american interests, and etc. but, the russians must ultimately seek to reduce persian power, and are already opening up a potential pandora's box in doing what they're already doing. when america is gone, the byzantine-persian conflict will persist. the russians have an existential stake in ensuring that they remain the dominant power in that relationship.
i'm just requesting that people be careful enough in their analysis to adjust to the shifting realities, as this is a real thing that is happening, and is likely to accelerate.
so, could we lose america before we lose capitalism? is that what is ruffling these old leftists, who have identified the two things as the same thing? how is this possible?
i will tell you, authoritatively: we will lose america before we lose capitalism, america will not be where the revolution takes place and america will not be the society that leads us into socialism, or into communism. capitalism will not be the same, without america. but, america only has itself to blame for it's decline. and, that decline has been apparent, for decades.
so, this should not shock any old leftists at all. it's just a question of realizing what's happening.
jagmeet singh must cut his beard.
activists on the ground: yes, turkey is still in nato. but, it's a formality, at this point.
the turks are currently actively acting against american interests, and actively aligning with the russians.
i know that you're used to seeing nato as this monolithic thing, where orders are barked from washington. but, this started to break down in the bush administration, was band-aid-ed over by obama, even as he put events in motion that would ultimately weaken american leadership, and has now completely imploded, fairly quickly, under trump. the return of russian power is a consequence of a lack of american leadership, more so than it is a complicating factor.
a return to a multipolar world doesn't and shouldn't change basic political allegiances, and the rojava are certainly worth standing in solidarity with, whatever their flaws. but, it calls for a sharper analysis and a more careful attention to details.
the old alliances are just that, now: old alliances. and, turkey's re-alignment is likely the beginning of things, rather than an isolated happening.
the turks have reason to align with the persian empire - and the kurds are likely the power that will return the persians to empire, one day. but, the russians cannot align with the persians, these are historically competitive empires. they can dominate the persians, they can act as a counter-balance to american interests, and etc. but, the russians must ultimately seek to reduce persian power, and are already opening up a potential pandora's box in doing what they're already doing. when america is gone, the byzantine-persian conflict will persist. the russians have an existential stake in ensuring that they remain the dominant power in that relationship.
i'm just requesting that people be careful enough in their analysis to adjust to the shifting realities, as this is a real thing that is happening, and is likely to accelerate.
so, could we lose america before we lose capitalism? is that what is ruffling these old leftists, who have identified the two things as the same thing? how is this possible?
i will tell you, authoritatively: we will lose america before we lose capitalism, america will not be where the revolution takes place and america will not be the society that leads us into socialism, or into communism. capitalism will not be the same, without america. but, america only has itself to blame for it's decline. and, that decline has been apparent, for decades.
so, this should not shock any old leftists at all. it's just a question of realizing what's happening.
jagmeet singh must cut his beard.
at
22:05
the evidence *is* fairly
clear that stimulus works, and tax cuts don't. i mean, this shouldn't be
an ideological debate. and, it is trump that is living in the world of
economic unicorns, holding to ideas that don't just lack empirical
support, but have been demonstrably proven as ineffective - while
trudeau is really holding to the textbook on economics, here: growth is
driven by increases in aggregate demand. wage increases are far more
effective than tax cuts in increasing this.
trudeau is right, here. trump isn't.
but, there was a poll that said that the conservative party propaganda - and that is what it is - about harper being a strong economic leader has had some kind of brainwashing effect, so here comes good old lorne hunter to enforce the lies. this isn't actually news, though. harper was outpolling trudeau on the economy right up to the election, remember, and still lost. you started seeing the numbers diverge when the ndp was leading: harper consistently did the best on the economy, but was still losing in every poll. how do you explain that? my analysis of this at the time is that people didn't really understand what they were telling pollsters, they were just repeating the marketing. the tv says harper is better on the economy, so he must be, right? but, if you try and ask them to explain *why*, you're not even going to get a coherent answer at all, let alone a confused one. they've never really thought about it, they're just taking the commercials on tv as an authority. because the tv doesn't lie, right?
i actually think that the oversaturation to economic messaging from the conservatives has probably led to a kind of ultra-paradoxical phase: they may accept that the conservatives are better on the economy without knowing what that means, they might obediently repeat the propaganda, but that doesn't appear to be affecting voting decisions, at this point, because they don't actually understand what the conservative party means when they say they're best on the economy. so, they take it as a given, but they don't understand what it actually means. i mean, this isn't an accident: the party obscures bad policies with vague messaging that obscures what they're actually doing. so, voters seem to be having difficulty tying the propaganda to actual policies, and then realize they don't support the policies that are apparently so good for the economy when presented with them. but, they repeat it, when polled on it, anyways.
i would suggest that the effects of this are going to be that the younger generation is not going to put the economy at the top of their voting priorities, and that's a deep social change. but, it's a reaction to the conservative propaganda. and, the country could very well end up economically better off as a consequence of it.
i kept asking steve if his economic action plan was a four-year plan or a five-year plan, and i never got an answer. but, i guess he had a majority for four years, right?
http://torontosun.com/opinion/columnists/gunter-trudeau-stakes-our-future-on-hipster-economics
jagmeet singh must cut his beard.
trudeau is right, here. trump isn't.
but, there was a poll that said that the conservative party propaganda - and that is what it is - about harper being a strong economic leader has had some kind of brainwashing effect, so here comes good old lorne hunter to enforce the lies. this isn't actually news, though. harper was outpolling trudeau on the economy right up to the election, remember, and still lost. you started seeing the numbers diverge when the ndp was leading: harper consistently did the best on the economy, but was still losing in every poll. how do you explain that? my analysis of this at the time is that people didn't really understand what they were telling pollsters, they were just repeating the marketing. the tv says harper is better on the economy, so he must be, right? but, if you try and ask them to explain *why*, you're not even going to get a coherent answer at all, let alone a confused one. they've never really thought about it, they're just taking the commercials on tv as an authority. because the tv doesn't lie, right?
i actually think that the oversaturation to economic messaging from the conservatives has probably led to a kind of ultra-paradoxical phase: they may accept that the conservatives are better on the economy without knowing what that means, they might obediently repeat the propaganda, but that doesn't appear to be affecting voting decisions, at this point, because they don't actually understand what the conservative party means when they say they're best on the economy. so, they take it as a given, but they don't understand what it actually means. i mean, this isn't an accident: the party obscures bad policies with vague messaging that obscures what they're actually doing. so, voters seem to be having difficulty tying the propaganda to actual policies, and then realize they don't support the policies that are apparently so good for the economy when presented with them. but, they repeat it, when polled on it, anyways.
i would suggest that the effects of this are going to be that the younger generation is not going to put the economy at the top of their voting priorities, and that's a deep social change. but, it's a reaction to the conservative propaganda. and, the country could very well end up economically better off as a consequence of it.
i kept asking steve if his economic action plan was a four-year plan or a five-year plan, and i never got an answer. but, i guess he had a majority for four years, right?
http://torontosun.com/opinion/columnists/gunter-trudeau-stakes-our-future-on-hipster-economics
jagmeet singh must cut his beard.
at
21:30
it's starting to look like the aristocrat swooping in is caroline mulroney.
that's a dramatic entrance to high level politics, for somebody that one might assume ought to run in quebec.
it will be interesting to see how this unfolds. i do believe that she has an existing media footprint, and would no doubt be used by the tory elites as a front, managed through that media image - you could call it the trudeau model. but, i have my doubts about the applicability of the trudeau model to provincial politics, where turnout is lower and voters tend to be more informed.
i'd like to see them try this, really - because i don't think it will work. not a mulroney. not in ontario. but, what an experiment...
to be clear: who knows if what happened will ever come out in the form of actual evidence, but a little deductive reasoning is suggesting that the way has been paved for mulroney to move in, as the preferred option of the party executive, which wants to manage the office ceremonially and pull actual decision making into the party executive. well, the liberals just did it, federally. and, it's working.
it's of course going to be the excuse to wipe patrick brown's platform away, as well. new leader, new ideas. if the tories veer right and lose the election, as they always do, this is going to be a question that people will ask: might they had won with patrick brown and his platform? if they hadn't got cocky...
i dunno. i'm a logician, not a clairvoyant. and, we're going to need to wait for the dust to settle before we even look for a signal. but, if what appears to be happening is what is happening, i think it's going to backfire: i think the mulroney name is going to backfire, and i think people aren't going to take her seriously as an applicant to the premier's office.
jagmeet singh must cut his beard.
that's a dramatic entrance to high level politics, for somebody that one might assume ought to run in quebec.
it will be interesting to see how this unfolds. i do believe that she has an existing media footprint, and would no doubt be used by the tory elites as a front, managed through that media image - you could call it the trudeau model. but, i have my doubts about the applicability of the trudeau model to provincial politics, where turnout is lower and voters tend to be more informed.
i'd like to see them try this, really - because i don't think it will work. not a mulroney. not in ontario. but, what an experiment...
to be clear: who knows if what happened will ever come out in the form of actual evidence, but a little deductive reasoning is suggesting that the way has been paved for mulroney to move in, as the preferred option of the party executive, which wants to manage the office ceremonially and pull actual decision making into the party executive. well, the liberals just did it, federally. and, it's working.
it's of course going to be the excuse to wipe patrick brown's platform away, as well. new leader, new ideas. if the tories veer right and lose the election, as they always do, this is going to be a question that people will ask: might they had won with patrick brown and his platform? if they hadn't got cocky...
i dunno. i'm a logician, not a clairvoyant. and, we're going to need to wait for the dust to settle before we even look for a signal. but, if what appears to be happening is what is happening, i think it's going to backfire: i think the mulroney name is going to backfire, and i think people aren't going to take her seriously as an applicant to the premier's office.
jagmeet singh must cut his beard.
at
06:48
Friday, January 26, 2018
i think that the point that he's making is actually that the undrip is likely to be declared unconstitutional in canada, but he's lost himself down the unlikely path that occurs when the courts interpret international law as of greater importance than constitutional law, which is a non-starter, and not in their mandate.
it follows that the liberals can go ahead and support this bill, in order to avoid the optics of opposing it because it will amount to little. i wouldn't expect anybody to go through the formal process of striking anything down. and, it also follows that what romeo saganash ought to be pressing for is an opening up of the constitution, because that is the level of law that needs to be addressed in order to implement undrip in canada - at least rigorously.
a private member's bill like this is really equivalent to a non-binding resolution. and, everybody involved in putting it together is fully aware of it.
i want to be clear: the canadian constitution has specific provisions for indigenous rights, and they have been developed by the courts over the last several decades. that is the law that the canadian judicial system will defer to and, in the presence of any contradictions, any international law reintroduced as domestic law would be declared null. for, that is what a private member's bill is - domestic legislation, subject to constitutional challenge. but, the unconstitutionality of the document doesn't come in a void, in canada. we already have a legal mechanism in place.
the article is basically right - bringing in the undrip would cause havoc on the judicial system. but, the judicial system is neither obligated nor likely to accept this interference into the independence of the judiciary; the fact that it would cause havoc is why it won't happen.
we've been seeing this undrip thing play out for years, though. it's a dead end, in canadian law, and everybody has to understand that, so it all seems kind of fishy. in fact, the constitutional discussions held during the meech lake accords (which the push for undrip has erased from activist memory) explored a lot of the same issues being looked at in the undrip, and would provide a far better starting point for serious legislative action.
opening up the constitution won't be easy. but, it will be the only way to fundamentally change the legal framework overseeing the project of canadian imperialism; these private members bills, they do nothing. the process unfolding in the courts may lead to greater and greater amounts of compensation and local democracy around specific settlements, but it will ultimately maintain the allodial land rights of the crown to make decisions, made or not, to exploit the land. to change that is too deeply embedded in our laws for it to change by a declaration in the house. that is a constitutional level of change, in canada.
http://business.financialpost.com/opinion/the-trudeau-government-signs-on-to-give-aboriginals-veto-rights-nobody-else-has
jagmeet singh must cut his beard.
it follows that the liberals can go ahead and support this bill, in order to avoid the optics of opposing it because it will amount to little. i wouldn't expect anybody to go through the formal process of striking anything down. and, it also follows that what romeo saganash ought to be pressing for is an opening up of the constitution, because that is the level of law that needs to be addressed in order to implement undrip in canada - at least rigorously.
a private member's bill like this is really equivalent to a non-binding resolution. and, everybody involved in putting it together is fully aware of it.
i want to be clear: the canadian constitution has specific provisions for indigenous rights, and they have been developed by the courts over the last several decades. that is the law that the canadian judicial system will defer to and, in the presence of any contradictions, any international law reintroduced as domestic law would be declared null. for, that is what a private member's bill is - domestic legislation, subject to constitutional challenge. but, the unconstitutionality of the document doesn't come in a void, in canada. we already have a legal mechanism in place.
the article is basically right - bringing in the undrip would cause havoc on the judicial system. but, the judicial system is neither obligated nor likely to accept this interference into the independence of the judiciary; the fact that it would cause havoc is why it won't happen.
we've been seeing this undrip thing play out for years, though. it's a dead end, in canadian law, and everybody has to understand that, so it all seems kind of fishy. in fact, the constitutional discussions held during the meech lake accords (which the push for undrip has erased from activist memory) explored a lot of the same issues being looked at in the undrip, and would provide a far better starting point for serious legislative action.
opening up the constitution won't be easy. but, it will be the only way to fundamentally change the legal framework overseeing the project of canadian imperialism; these private members bills, they do nothing. the process unfolding in the courts may lead to greater and greater amounts of compensation and local democracy around specific settlements, but it will ultimately maintain the allodial land rights of the crown to make decisions, made or not, to exploit the land. to change that is too deeply embedded in our laws for it to change by a declaration in the house. that is a constitutional level of change, in canada.
http://business.financialpost.com/opinion/the-trudeau-government-signs-on-to-give-aboriginals-veto-rights-nobody-else-has
jagmeet singh must cut his beard.
at
16:15
so, those girls weren't legally underage for sexual consent, although one was underage for drinking. it's a technical twist that ought to matter but ultimately doesn't. it's crass enough behaviour to be disqualified from public office.
and, as to the precise question of his resignation, his guilt isn't even a factor - he was asked to resign because of the distraction the allegations would create around the campaign. he should be free to run in the upcoming leadership campaign, should the accusations be demonstrated frivolous in due time. it's just that this narrative around due process is missing the point; he is being asked to resign so that he can go through with his due process in a way that is severed from the party that is running for office. he can't be asked to do both things simultaneously, and the public can't be asked to multitask on that level.
could that happen to anyone? well, yeah. and, anyone that it might happen to ought to be entitled to a leave of absence to attempt to clear their names of charges. but, a running premier can't take a leave of absence, so he must be dismissed instead.
the fact that he might be likely to defeat the charges is immaterial in the decision. politics is hard.
but, if this is truly frivolous, who might be responsible for it?
well, i think it was ultimately the democrats that took out al franken. might somebody in the conservative party be watching too much game of thrones? well, it's a plum position to be in, in a potential backlash election. a coveted spot. might somebody more powerful have taken it away from him? or, maybe it was a disgruntled group of hard right conservatives that wanted to stop brown from steering the party into the centre...
of course, it might have been kathleen wynne. that would be a sneaky move. and, invite retaliation - and a potentially stronger opponent.
i'm not sure the motives add up for any of the suspects, here, besides a usurpation from above. and, if true, i suppose a potential suspect will make itself known, in time.
jagmeet singh must cut his beard.
and, as to the precise question of his resignation, his guilt isn't even a factor - he was asked to resign because of the distraction the allegations would create around the campaign. he should be free to run in the upcoming leadership campaign, should the accusations be demonstrated frivolous in due time. it's just that this narrative around due process is missing the point; he is being asked to resign so that he can go through with his due process in a way that is severed from the party that is running for office. he can't be asked to do both things simultaneously, and the public can't be asked to multitask on that level.
could that happen to anyone? well, yeah. and, anyone that it might happen to ought to be entitled to a leave of absence to attempt to clear their names of charges. but, a running premier can't take a leave of absence, so he must be dismissed instead.
the fact that he might be likely to defeat the charges is immaterial in the decision. politics is hard.
but, if this is truly frivolous, who might be responsible for it?
well, i think it was ultimately the democrats that took out al franken. might somebody in the conservative party be watching too much game of thrones? well, it's a plum position to be in, in a potential backlash election. a coveted spot. might somebody more powerful have taken it away from him? or, maybe it was a disgruntled group of hard right conservatives that wanted to stop brown from steering the party into the centre...
of course, it might have been kathleen wynne. that would be a sneaky move. and, invite retaliation - and a potentially stronger opponent.
i'm not sure the motives add up for any of the suspects, here, besides a usurpation from above. and, if true, i suppose a potential suspect will make itself known, in time.
jagmeet singh must cut his beard.
at
01:14
Thursday, January 25, 2018
i thought about this, and i actually think the ndp would have a bigger pull under the imminent threat of a conservative win.
the conservatives will have a new leader in place before the election. patrick brown is off the ballot, but the party will still be on it. so, those people that are trained to vote for the conservative logo as a default replacement option will still be able to do so, and if the vote is explicitly against wynne then the replacement of brown should change little in the decision making process.
i'm not convinced that the backlash is so strong, right now. all of those polls had very high numbers of undecideds. but, there is no real reason to think a change in leadership will prevent it, if it is. andrea horwath has been there the whole time; the people that are singularly irate with wynne would already be leaning ndp, if they were so inclined.
i mean, the article is written as though brown is taking the entire conservative party out of the election, and the ndp are the only other option left standing. that's not an approximation of reality at all.
wynne is more likely to use this to appeal to centrist voters concerned about stability. the tories need to get their own party in order before they can start considering forming a government, kind of thing.
https://www.thestar.com/opinion/star-columnists/2018/01/25/patrick-brown-sex-scandal-boosts-fortunes-of-andrea-horwath-and-the-ndp.html
jagmeet singh must cut his beard.
the conservatives will have a new leader in place before the election. patrick brown is off the ballot, but the party will still be on it. so, those people that are trained to vote for the conservative logo as a default replacement option will still be able to do so, and if the vote is explicitly against wynne then the replacement of brown should change little in the decision making process.
i'm not convinced that the backlash is so strong, right now. all of those polls had very high numbers of undecideds. but, there is no real reason to think a change in leadership will prevent it, if it is. andrea horwath has been there the whole time; the people that are singularly irate with wynne would already be leaning ndp, if they were so inclined.
i mean, the article is written as though brown is taking the entire conservative party out of the election, and the ndp are the only other option left standing. that's not an approximation of reality at all.
wynne is more likely to use this to appeal to centrist voters concerned about stability. the tories need to get their own party in order before they can start considering forming a government, kind of thing.
https://www.thestar.com/opinion/star-columnists/2018/01/25/patrick-brown-sex-scandal-boosts-fortunes-of-andrea-horwath-and-the-ndp.html
jagmeet singh must cut his beard.
at
21:55
i think that fallout from the patrick brown situation is unclear; if you're the liberals, this is almost an act of god, and it's really just out of nowhere...
one substantive factor likely lies in how the conservative base reacts to it on social media and in conversation. the party might take swift actions to try and neutralize what it sees as a nightmare, in an attempt to appeal to...sane people, really. but, you know that the good old conservative base is going to yell and scream about feminism, and how he was set up by a clique of feminazis trying to silence him.
i'm not suggesting that such a movement has legs. not in ontario. not in 2017. but, these idiots are vocal, and this is the kind of troll that they love to get in people's faces on - and that people get pissy about, quickly. here's your free market, guys - you have no control over how your voters represent your image on social media, which is the media people actually use.
avoid your uncle on facebook this week.
and, the accusations are....they're substantive because she was underage. but, that's one of the arguments that the mras love to go to town with, isn't it? "i thought she was legal. how am i supposed to know?".
but, the candidates will address their opponents, and soon enough be eager to push patrick brown out of the news cycle. wynne probably wins by default, now. but, that zombie conservative vote really is stubborn, you know.
one substantive factor likely lies in how the conservative base reacts to it on social media and in conversation. the party might take swift actions to try and neutralize what it sees as a nightmare, in an attempt to appeal to...sane people, really. but, you know that the good old conservative base is going to yell and scream about feminism, and how he was set up by a clique of feminazis trying to silence him.
i'm not suggesting that such a movement has legs. not in ontario. not in 2017. but, these idiots are vocal, and this is the kind of troll that they love to get in people's faces on - and that people get pissy about, quickly. here's your free market, guys - you have no control over how your voters represent your image on social media, which is the media people actually use.
avoid your uncle on facebook this week.
and, the accusations are....they're substantive because she was underage. but, that's one of the arguments that the mras love to go to town with, isn't it? "i thought she was legal. how am i supposed to know?".
but, the candidates will address their opponents, and soon enough be eager to push patrick brown out of the news cycle. wynne probably wins by default, now. but, that zombie conservative vote really is stubborn, you know.
at
09:23
just so it's clear, the text at astana was largely written by the russians - and the americans weren't invited. i suppose it doesn't alter complicity. but, not only is this attack not nato-sanctioned, it's russian-orchestrated.
at
03:18
Wednesday, January 24, 2018
Osmund Cooke
Not sure if I was listening carefully, but can an enzyme split an atom and create nuclear fission?
Something like oxidoreductase or acid base catalysis
deathtokoalas
i believe you can find evidence for your hypothesis in the phenomenon of explosive diarrhoea.
at
19:51
this idea in the anti-gmo movement that you can absorb modified dna somehow is science fiction. organisms can steal dna from other organisms, but it is something that becomes less and less feasible as life becomes more and more complex.
what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.
maybe some diagrams might help.
suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata
your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata
your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.
there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.
jagmeet sing must cut his beard.
what actually happens to the dna that you consume from gmos is the same thing that happens to all of the other dna that you eat - it gets digested. see, the gmo corn that you're eating ends up in your stomach, which is an internal organ full of dissolved ions ready to break any complex chains into their constituent parts: proteins into amino acids, carbohydrates into glucose molecules and dna into nucleotides. your stomach ions are unable to determine that the dna has been modified, as it is being disassembled into nucleotides.
maybe some diagrams might help.
suppose this is a non gmo string of dna:
agtcgatagctcgagagatattgcgctagtagatgctctatata
your body will disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
now, suppose that this string of dna is altered to this:
agtcgatagctcgcgctagtagatgctctatata
your body will still disassemble this string of dna into nucleotides, and utilize those nucleotides as it sees fit.
so, what is this concern that we're going to absorb screwy dna? well, it's based on the old myth that you are what you eat. another manifestation of this myth is the idea that if you eat foods that are high in cholesterol then you will somehow absorb that cholesterol. no. your body disassembles the cholesterol and puts it back together again, as it sees fit. if you have high cholesterol, it's because you're eating too many carbohydrates - you're getting too much glucose. this myth is pervasive, though, because people don't at all understand how their own bodies work, despite the science being readily available.
there's good reasons to oppose multinational chemical firms, in general, as they tend to demonstrate little concern for human rights and environmental stability. but, the way to do that is not through organizing against science. and, i would rather consider it more pressing to push back against any kind of anti-science movement, as the solution has to be through implementing a more integrated application of science.
jagmeet sing must cut his beard.
at
19:17
an opportunity, perhaps, but, as justin is not his father, this is not the ndp of the 60s or the 70s, either. i frankly don't think they have the credibility on the left to put up a believable opposition to free trade. this is where the ghost of mulcair appears and haunts the ndp forever, as he was very tepid in his criticism of the tpp, and projected fairly clearly that he intended to support it if he had won in 2015. if i am correct that jagmeet singh is a creature of the ndp leadership, it's not even clear what the actual policy position even is, let alone if they can lead an opposition movement that is, issue-by-issue, well to the left of where the party currently sits.
in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.
i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...
https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html
jagmeet singh must cut his beard.
in the existing spectrum, i might rather propose that the greens are best positioned to take advantage of an alter-globalization movement, although they would be far better positioned to do this had they undergone a change in leadership after the last election. elizabeth may will never generate enthusiastic support amongst leftists. however, if it can find the right candidates, it could be a tipping point in key ridings.
i think the reality is rather more that the left in canada is currently too disorganized to form an effective resistance to this, and if the signature has any effect at all, it will be in acting as a catalyst to help it organize for the next deal. if we are to be optimistic, we might hope that a citizen's movement might look back at this moment as a low point, where people started to organize. but, the deal itself will not be meaningfully opposed...
https://www.thestar.com/opinion/star-columnists/2018/01/24/trudeaus-pacific-trade-deal-creates-an-opportunity-for-the-ndp.html
jagmeet singh must cut his beard.
at
18:39
but, what would you do if you were free?
i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.
see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.
immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.
unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.
because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.
so, what would you do if you were free?
then, do it.
jagmeet singh must cut his beard.
i decided a long time ago that i'd struggle more if i were immortal. it's just the time scale required to adhere to the struggle; it's certainly beyond my projected lifetime, and by several generations.
see, a part of struggling is expecting to spend time in jail, and in the court procedures accompanying imprisonment. immortality becomes a pre-requisite for this to be a valid use of existence, as even the slightest amount of time forfeited is horrendously wasted in any situation of mortality. i'm on the opposite side of marx' criticism of christianity; now that i see myself in the mirror, i can't be bothered to waste my time on this earth struggling.
immortality is a complicated factor to throw into the struggle, though. it both opens up a vacuum of power, as imprisonment is merely a delay, and deeply complicates the moral questions around capital punishment, as to end a life that would otherwise not end is a much more profound crime than to end a life that would otherwise end, anyways. premature death is less grave than death in the absence of the inevitability of it. at least, it must be to anybody that contemplates the matter - although many would no doubt not even bother to do as much as that. the state is rather faced with a more stark question around terminating irresolvable problem cases, but that would be exactly what it would label those who struggle. rather, one might hope that human immortality does not precede distributive justice, so that once the struggle enters the immortal plane it is primarily academic and enacted bureaucratically.
unfortunately, i expect to be limited by the bounds of mortality for the tenure of my existence. but, realizing the futility of existence means realizing the irrelevance of the chains we are enslaved with, for they do not actually exist, except in our minds. it's too hard to control us physically, so they brainwash us instead. and, this method of control is remarkably successful! but, it comes with some dead weight, because the plebs that figure it out have nothing holding them back, or in place.
because we're mortal, and the chains are not real, we don't need to struggle - we can just ignore the fact that we're slaves. and, we can get away with it, because the infrastructure to keep us in line is too expensive to bother with, because we're not a threat to the system anyways - we're not struggling.
so, what would you do if you were free?
then, do it.
jagmeet singh must cut his beard.
at
11:49
Tuesday, January 23, 2018
so, they signed the tpp.
i would have rather seen a bilateral deal with japan...
why didn't they sign it previously? well, you'd think it probably had something to do with wanting to wait to see what was happening in the united states. a canadian entrance into the tpp could have severely complicated nafta talks.
and, the timing of signing on to the deal is no doubt informed by recent events around the nafta negotiation. that may seem ominous, but i think you can also read it the other way - the liberals may have calculated that trump will not be able to re-open nafta in the face of congressional opposition by 2024, and that these talks will rather go on until trump leaves or is removed from the white house. they may also have calculated that the united states will return to the tpp in 2022 or 2026.
the standard narrative is going to be that it's a pre-emptive reaction to the imminent collapse of nafta, but the facts would hardly uphold it. two-way trade is really only going to exist with japan and perhaps australia; the rest of the countries are going to act as...
trump thinks that the tpp is a backdoor for china. it's crazy. the tpp is the exact opposite: it's the reconstruction of the wartime japanese empire, to act as a counter-balance to contain the chinese with. so, the bulk of these countries exist in the deal to provide natural resources and labour to japanese multinationals, who will then sell the products in north america - or at least in canada. the labour provisions in the agreement are a joke, really.
then, you've got singapore for money laundering and other banking functions.
how is that going to replace nafta? the japanese market for beef is not that powerful, although the alberta farming lobby no doubt pushed hard for the deal.
it makes more sense to think that canada has made the choice to act independently of trump, for the reason that it doesn't have much faith in trump to chart a path, and rather has better reason to think the future will be designed by his opponents.
jagmeet singh must cut his beard.
i would have rather seen a bilateral deal with japan...
why didn't they sign it previously? well, you'd think it probably had something to do with wanting to wait to see what was happening in the united states. a canadian entrance into the tpp could have severely complicated nafta talks.
and, the timing of signing on to the deal is no doubt informed by recent events around the nafta negotiation. that may seem ominous, but i think you can also read it the other way - the liberals may have calculated that trump will not be able to re-open nafta in the face of congressional opposition by 2024, and that these talks will rather go on until trump leaves or is removed from the white house. they may also have calculated that the united states will return to the tpp in 2022 or 2026.
the standard narrative is going to be that it's a pre-emptive reaction to the imminent collapse of nafta, but the facts would hardly uphold it. two-way trade is really only going to exist with japan and perhaps australia; the rest of the countries are going to act as...
trump thinks that the tpp is a backdoor for china. it's crazy. the tpp is the exact opposite: it's the reconstruction of the wartime japanese empire, to act as a counter-balance to contain the chinese with. so, the bulk of these countries exist in the deal to provide natural resources and labour to japanese multinationals, who will then sell the products in north america - or at least in canada. the labour provisions in the agreement are a joke, really.
then, you've got singapore for money laundering and other banking functions.
how is that going to replace nafta? the japanese market for beef is not that powerful, although the alberta farming lobby no doubt pushed hard for the deal.
it makes more sense to think that canada has made the choice to act independently of trump, for the reason that it doesn't have much faith in trump to chart a path, and rather has better reason to think the future will be designed by his opponents.
jagmeet singh must cut his beard.
at
18:03
i don't see any value in this liberal strategy to try and deflect from
trudeau's privileged class status, not because it isn't in some sense a liability - and it should be stressed that this is an about-face from the glossy magazine photos that i criticized - but because it isn't believable.
everybody knows that justin trudeau is an aristocrat. so, attempts to deflect from or distort this seem like an attempt to construct a parallel reality, which i guess is only really an error insofar as it is so transparently fraudulent. they're just replacing one unbelievable narrative with another.
campaign rhetoric aside, no sane person thought justin trudeau was going to be a representative of the middle class, and that's not why he got elected. he was elected on a social liberalization platform, which was a bundle of ideas that included the right to wear scarves in public and the right to smoke up without going to jail. there was maybe some hope that he might bring in people that would help ensure our descendants have the right to live on a habitable planet, but these are the kinds of decisions that are made by corporate aristocrats, and the hope that he might have some influence was actually reliant on him using that elite status for influence.
i guess the cynical analysis is that the narrative shift is meant to accompany a policy shift that will align the liberals to the center-right, which is where they have tended to stabilize towards during long periods of safe governance, and where they've largely sat since coming back into office. they've tended to avoid this kind of messaging, but the recent absorption of the aging progressive conservative intelligentsia may be leading them to project phantom demographics into the future. that swing vote won't be replaced, when it dies, and it's almost dead; instead, you'll have a fundamental shift in the number of voters that call themselves 'liberals', because they always have been - and whether this is a 5% or 10% tipping point will determine if the conservative party is a viable vehicle moving into the future, and whether the ndp is a perpetual opposition party or not, as these no longer young voters have now overwritten their parents' conservative identity with their own liberal identity, and are consequently reachable from the left. the fact that the ndp is currently a distraction, at best, doesn't affect the demographics that are emerging.
in canada, that means a shift from a left that takes up 60-65% of the spectrum to a left that takes up 65-75% of it.
but, this is what happens to all liberal governments - they get some support from pragmatic conservatives at the beginning of their mandate, and then design their policies to try and appeal to conservative voters, then get confused when they crater on both sides, as those pragmatic conservatives still always prefer the conservatives, in the end.
if it were up to me, i would not be having trudeau making apologies for his status. i'd be having him demonstrate results to the cameras.
jagmeet singh must cut his beard.
everybody knows that justin trudeau is an aristocrat. so, attempts to deflect from or distort this seem like an attempt to construct a parallel reality, which i guess is only really an error insofar as it is so transparently fraudulent. they're just replacing one unbelievable narrative with another.
campaign rhetoric aside, no sane person thought justin trudeau was going to be a representative of the middle class, and that's not why he got elected. he was elected on a social liberalization platform, which was a bundle of ideas that included the right to wear scarves in public and the right to smoke up without going to jail. there was maybe some hope that he might bring in people that would help ensure our descendants have the right to live on a habitable planet, but these are the kinds of decisions that are made by corporate aristocrats, and the hope that he might have some influence was actually reliant on him using that elite status for influence.
i guess the cynical analysis is that the narrative shift is meant to accompany a policy shift that will align the liberals to the center-right, which is where they have tended to stabilize towards during long periods of safe governance, and where they've largely sat since coming back into office. they've tended to avoid this kind of messaging, but the recent absorption of the aging progressive conservative intelligentsia may be leading them to project phantom demographics into the future. that swing vote won't be replaced, when it dies, and it's almost dead; instead, you'll have a fundamental shift in the number of voters that call themselves 'liberals', because they always have been - and whether this is a 5% or 10% tipping point will determine if the conservative party is a viable vehicle moving into the future, and whether the ndp is a perpetual opposition party or not, as these no longer young voters have now overwritten their parents' conservative identity with their own liberal identity, and are consequently reachable from the left. the fact that the ndp is currently a distraction, at best, doesn't affect the demographics that are emerging.
in canada, that means a shift from a left that takes up 60-65% of the spectrum to a left that takes up 65-75% of it.
but, this is what happens to all liberal governments - they get some support from pragmatic conservatives at the beginning of their mandate, and then design their policies to try and appeal to conservative voters, then get confused when they crater on both sides, as those pragmatic conservatives still always prefer the conservatives, in the end.
if it were up to me, i would not be having trudeau making apologies for his status. i'd be having him demonstrate results to the cameras.
jagmeet singh must cut his beard.
at
17:29
the reasons trump is doing this don't have anything to do with workers; one might rather note trump's treatment of south korea as a chinese satellite with a level of alarm. but, it could very well provide incentives for korean and chinese businesses to manufacture more goods in the united states, which would indeed import some jobs from elsewhere into the united states. but, at what retaliatory cost is unclear.
i don't have any particular aversion to tariffs in principle, it's more that using them is a really tricky game that requires quite a bit of mathematical analysis and intelligent foresight - qualities the president does not have. tariffs should certainly not be used haphazardly as a hegemonic tool of control, but that box is already long open.
http://www.bbc.com/news/business-42784380
i don't have any particular aversion to tariffs in principle, it's more that using them is a really tricky game that requires quite a bit of mathematical analysis and intelligent foresight - qualities the president does not have. tariffs should certainly not be used haphazardly as a hegemonic tool of control, but that box is already long open.
http://www.bbc.com/news/business-42784380
at
03:35
Subscribe to:
Posts (Atom)